This entry represents the N-terminal domain found in DUF7855 family proteins found in halobacteria. This domain is predicted to mediate dimerisation as well as DNA-binding. This domain belongs to the dimeric alpha/beta barrel superfamily. There is a notable pocket in each subunit beneath the DNA-binding interface that might might to a small molecule to regulate DNA-binding. The protein A0A371M7Z4 appears to bind to the DNA sequence GAGGTTACCTGGGCCAGGTAACCTC (pTM-0.9 iPTM=0.89).
","llm":false,"checked":false,"updated":false}],"wikipedia":[{"title":"Domain_of_unknown_function","extract":"A domain of unknown function (DUF) is a protein domain that has no characterised function. These families have been collected together in the Pfam database using the prefix DUF followed by a number, with examples being DUF2992 and DUF1220. As of 2019, there are almost 4,000 DUF families within the Pfam database representing over 22% of known families. Some DUFs are not named using the nomenclature due to popular usage but are nevertheless DUFs.
","thumbnail":null}],"literature":null,"set_info":{"accession":"CL0032","name":"Dim_A_B_barrel"},"overlaps_with":null,"counters":{"subfamilies":0,"domain_architectures":2,"interactions":0,"matches":176,"pathways":0,"proteins":176,"proteomes":176,"sets":1,"structural_models":{"alphafold":166},"structures":0,"taxa":264},"entry_annotations":{"hmm":0,"logo":0,"alignment:seed":45,"alignment:full":75},"cross_references":{},"is_llm":false,"is_reviewed_llm":false,"is_updated_llm":false,"representative_structure":null}}