EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF08173 alignment
(11 sequences with 84 bp)


Q5NI15_FRATT/1-28 ATGTATTATTTAGCATGGATTATATCAGCTGGTCTAGCAGTTACAGTAGGTTGTTTCGTAGCTACTAGATTAGAAAAAAAAGAA
Q62F72_BURMA/1-28 ATGTGGTACTTCAGCTGGATTCTCGGCATCGGCGTCGCGCTCGCGTTCGGCATCATCAATGCGATGTGGCTCGAAGCGCGGCAA
Q83CY4_COXBU/15-42 ATGTGGTATTTTGCTTGGATTCTAGGATTCGGTTTGGCTTGTGCATTCGCCATTCTTAACGCATTATGGTTTGAATTAGAGCGC
Q7W3K9_BORPA/1-28 ATGTGGTATTTCTCTTGGATTCTTGGCCTGAGCCTGGCGTGTGCGTTCGGCATCCTGAATGCGATGTGGTTCGAGTTGCGCGAA
Q8FWE3_BRUSU/14-41 ATGTGGTATTTTTCGTGGCTTTTGGGCCTGCCGCTTGCAGCCGCGTTCGCTGTGCTGAATGCGATGTGGTATGAGCTGATGGAC
Q8P8K6_XANCP/1-28 ATGTGGTATTTCGCATGGATTCTTGGCACCGGTCTGGCCGCACTGGCTGCCGTGCTCAACGGCATGTGGTTCGAGGCGCGCGAG
Q609X0_METCA/1-28 ATGTGGTATTTCGCGTGGATACTCGGGGTGGGTTTCGCATGTGCATTCGGTGTCATCAATGCCATGTGGTTGGAATCGGTCTGT
Q8DAM9_VIBVU/1-28 ATGTGGTATTTCGCATGGATTCTGGGTGTACTATTAGCGTGTGCATTCGGCATTATTAATGCTCTTTGGTTAGAGCACAGTGAA
Q65UN6_MANSM/1-28 ATGTTTTATTTAGCTTGGGTAGTGGGTGTGTTGTTAGCTATTTTAGCCAGTGTGATGATTACAATACGCATTGAAAAATCTGGA
Q7VKT8_HAEDU/1-28 ATGTTTTATGTAACATGGGTATTAGGTATTTTACTTGCTATTCTTTTTGCGACAGTGGTCACAATTGGCATTGAGAAAAGCGGT
YCCB_ECOLI/1-28 ATGTGGTATTTACTTTGGTTCGTCGGCATTTTGTTGATGTGTTCGCTCTCCACCCTTGTGTTGGTATGGCTGGACCCGCGTCTG