EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF08051 alignment
(2 sequences with 45 bp)


Q7BVC8_CORST/1-15 ATGTTGATTTCAGGTACCGCTTTCTTGCGGTTGCGCACCAACCGC
LPRM_CORDI/1-15 ATGTTGATTTCAGGTACCGCTTTCTTGCGGTTGCGCACCAACCGT