EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07851 alignment
(4 sequences with 996 bp)


Y33B_DROME/5-333 TCGCTGAAAAACGAGTGGGAAGAACTCAATAAGGAGTTTGCCGAACTGGAGAGCTGCAACAGGCGGTACATCGAGCTGCTGGAACAGCTGCACAGCCATCAACAAATCTGCTTCAATGAGATCAAGCATCAGCGGTACCGCATGAACCAGATAACGACGTCTCTGCGACAGTTC------AAAGGGCCCGTTCCGGCGGAGGACAAGGAGAAGGTCGATGACCTGCACAAGATGACCTTGAAGCGCAAAGCGCAACTGCACGAAATCGAGCAATCCTTGCCAGCGAAATCCGGCCGCTATTTGCAGATAATCCTGGGCGATGTAAATGTCTCGATTCTCAACAGAAACGACAAAGTTCGCTATAAAGATGACTATGAAAAGTTTAAATTAATACTCAACGTAATTGGACTGATAATGGCCTTCTTC---AATTTGATATTCAACTACAGGGCCCTGGAGCTGGCCTTCATATTCCTGTTGGTCTGGTACTACTGCACCCTGACCATTCGCGAGTCCATCCTCAAGGTGAACGGCTCGAGGATCAAGGGCTGGTGGCGGGCGCACCACTTCATCTCTACGGTCGCCGCCGGTGTTCTATTGGTTTGGCCACAGGGCGAGCACTGGCAAATCTTCCGGATGCAGTTCATGTACTTCAACGTCTACATTAGCATTGTCCAGTATTTGCAGTTTGGCTACCAGAAGGGCCTGCTCTATCGACTGAAGGCGCTCGGCGAGCGGCACAACATGGACATCACCATCGAGGGCTTCCACTCGTGGATGTGGCGCGGTCTGAGCTTCCTGCTGCCCTTCCTGTTCATCGGCTACGGTTACCAGGCGTATAACGCGTGGACGCTCTACAAGTTGGCCTACAGCCCGCCGGATGCGCCGTGGCACGTGTCCGTGATGTCCGGACTGTTCCTGCTGCTCTTCGTGGGCAACATGGCCACCACTTTATGGGTGGTGCCCGAGAAGATACGCGAACGGGCCAAGGAGCGC
Q7QF35_ANOGA/5-334 GAGCTGGAGAAGGATTGGACCGAGCTGTCGGACGAGTACCGGAGCCTGGAGGCCGCCAACCAGCAGTACCAGGAGCTGCACGAGCGGCTGGAGGAAATGCAGGAAAAATGCACAAAACAAATACAGCACCAGCGCTACCGGATGCGGCAGATATCGAAAAACCTCAAAACGTACATGACGCAGGAGAAGCTGACGCCGGAGGACCGCGACAAGGTGACGCAGCTGGAGAAGAGCATCATGAAGCGGAAGGCGCAGATACACGAGATCGAGCAGGGCCTGCCGCAACAGAACAGCCAGTATCTGAAGATCATACTCGGCGACGTGAACGTGTCGATACTGAACCGCAACGACAAGATCCGGTACAAGGACGAGTACGAGAAGTTCAAGCTGATACTGAACGTGATCGGGCTGCTGCTGTCGTTTCTA---AACATTGTCTTCAACTACCGCGCACTCGAGCTCGTGTTTCTATTCCTGCTGGTGTGGTACTACTGCACGCTTACCATTAGGGAGTCCATACTGAAGGTGAACGGTTCGCGGATAAAGGGCTGGTGGCGGCTGCACCACTTCATCTCGACCGTCTGTGCCGGGGTGCTGCTCGTCTGGCCGCAGGGCGAACCGTGGCAGCTGTTCCGCTCGCAGTTCATGTACTTCAACGTCTACATCAGCCTGGTGCAGTACATGCAGTTCCGCTACCAGAAGGGCGTGCTGTACCGGCTGAAGGCGCTCGGCGAGCGGCACAACATGGACATCACGATCGAGGGCTTCCACTCGTGGATGTGGCGCGGGCTCAAGTTTCTCTTCCCGTTCCTGTTCGTCGGCTATCTGTTCCAGTTCTACAACGCGTGGACGCTCTACCGTCTCACGCAGCACCCGGACGCG---ACCTGGCAGATACCGGTGCTGAGCATTCTGTTCCTCATTCTGTTCGTGGGCAACAGCTTCACCACGCTGATGGTCATCCTGCAGAAGCAAACGGAGCGCACCGAGAACCGA
Q8R243_MOUSE/41-367 CGTTGCGAGCGCGAGTGGCACGAGCTGGAGGGAGAATTTCAGGAGCTGCAGGAGACACACAGGATCTATAAGCAGAAGCTGGAGGAGCTGACCTCCCTGCAGACGCTGTGCAGCACCTCCATCAGCAAGCAGAAGAGGCACCTGAAGGACCTGAAGCACACACTCCAGAGGTAC------AAGCGCCATTCCAGCCATGAGGAGGCGGCGCTCATCCAACAGATGACCGCCAACATTAAGGAGCGACAGAATGTCTTCTTTGACATGGAGGCCTACCTACCGAAGAAGAATGGGCTCTACTTGAATCTGGTTCTTGGCAACGTGAGCGTGACCCTCCTCAGCAATCAGGCCAAGTTTGCTTACAAGGATGAGTATGAGAAGTTTAAGCTCTACCTGACCATAATTCTTCTTCTGGGTGCTGTGGCGTGTCGATTTGTCCTTCATTACAGGGTGACCGATGAAGTCTTCAACTTCCTGCTCGTGTGGTATTACTGCACCTTGACCATTCGAGAGAGCATCCTCATCAGCAATGGTTCCAGAATCAAGGGCTGGTGGGTGTCTCACCATTATGTCTCCACGTTCCTGTCTGGAGTGATGCTGACTTGGCCTAATGGACTAATTTACCAGAAGTTTCGAAATCAGTTTTTAGCGTTCTCCATTTTTCAGAGCTGCGTTCAGTTTCTACAGTACTATTACCAGAGGGGCTGTCTCTACAGACTGCGGGCCCTGGGGGAGAGGAACCACCTGGACCTCACAGTGGAAGGGTTCCAATCCTGGATGTGGCGGGGCCTCACCTTCCTCCTGCCTTTCCTCTTCTGTGGCCATTTCTGGCAGCTCTACAATGCCGTCACCCTGTTTGAGCTCTCCACCCATGAGGAATGCAAAGAATGGCAGGTATTCGTGCTGGCTCTCACCTTCCTCATCCTCTTCCTGGGCAATTTTCTGACCACGCTCAAAGTTGTCCATGCCAAACTCCAC---------AAGAACAGA
Q86TE9_HUMAN/11-337 GACTGCCTGCGGGACTGGGAGGATCTACAGCAGGACTTCCAGAACATCCAGGAGACCCATCGGCTCTACCGCCTGAAGCTGGAGGAGCTGACCAAACTTCAGAACAATTGCACCAGCTCCATCACGCGGCAGAAGAAGCGGCTCCAGGAGCTGGCCCTCGCCCTGAAGAAATGC------AAACCCTCCCTCCCAGCAGAGGCCGAGGGGGCCGCACAGGAGCTGGAGAACCAGATGAAAGAGCGCCAAGGCCTCTTCTTTGACATGGAGGCCTATTTGCCTAAGAAGAATGGATTGTACCTGAGCCTGGTTCTGGGGAACGTCAACGTCACGCTCCTGAGCAAGCAGGCTAAGTTTGCCTACAAGGACGAGTATGAGAAGTTCAAGCTCTACCTCACCATCATCCTCATCCTCATCTCCTTCACTTGCCGCTTCCTGCTCAACTCCAGGGTGACAGATGCTGCCTTCAACTTCCTGCTGGTCTGGTACTACTGCACCCTGACCATCCGGGAGAGCATCCTCATCAACAACGGCTCCCGGATCAAAGGCTGGTGGGTGTTCCATCACTACGTGTCCGCCTTCCTGTCGGGAGTCATGCTGACGTGGCCCGACGGTCTCATGTACCAGAAATTCCGGAACCAATTCCTCTCCTTTTCCATGTACCAGAGCTTCGTGCAGTTTCTCCAGTACTACTACCAGAGCGGCTGCCTCTACCGCCTGCGGGCGCTGGGCGAGCGGCACACCATGGACCTCACTGTGGAGGGCTTCCAGTCCTGGATGTGGCGGGGCCTCACCTTCCTGCTGCCTTTTCTTTTCTTTGGACACTTCTGGCAGCTTTTTAACGCGCTGACGTTGTTCAACCTGGCCCAGGACCCTCAGTGCAAGGAGTGGCAGGTGCTTATGTGCGGCTTTCCCTTCCTCCTCCTTTTCCTCGGCAATTTCTTCACCACCCTGAGGGTTGTGCACCACAAGTTTCAC---------AGTCAGCGG