EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07473 alignment
(2 sequences with 84 bp)


CX9A_CONGL/61-88 TCTTGTAACAATTCTTGCCAGAGCCATTCCGATTGCGCATCCCATTGTATTTGCACGTTTAGAGGATGCGGAGCTGTCAATGGT
CXP9_CONRE/57-83 TTTTGTGGACAGGCGTGTTCGTCT---GTGAAATGCCCTAAGAAATGTTTTTGCCATCCTGAAGAGAAAGTTTGCTACCGAGAA