EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07421 alignment
(2 sequences with 507 bp)


NEUT_MOUSE/1-169 ATGAGAGGAATGAATCTCCAGCTGGTGTGCCTGACTCTCCTGGCTTTCAGCTCCTGGAGTCTGTGCTCAGATTCAGAAGAAGATGTGAGAGCCCTGGAGGCAGATCTATTGACAAACATGCATACATCCAAGATCAGCAAAGCAAGTCCTCCGTCTTGGAAAATGACCTTGCTAAATGTTTGCAGCCTCATAAATAACGTGAACAGCCCGGCCGAGGAAGCAGGAGACATGCATGATGACGACCTTGTTGGCAAAAGGAAACTTCCCCTTGTTCTGGATGGTTTTAGCTTGGAAGCAATGCTGACCATCTTCCAGCTCCAGAAAATCTGCCGCAGCAGGGCCTTTCAACACTGGGAGATAATCCAGGAAGATATCCTTGATAACGTCAATGATAAAAACGAGAAGGAAGAAGTGATAAAGAGAAAAATCCCTTATATTCTGAAAAGGCAGCTGTATGAAAATAAACCCAGAAGGCCCTACATTCTCAAGAGGGGTTCCTACTACTAC
NEUT_BOVIN/1-169 ATGGCAGGAATGAAAATCCAGCTGGTGTGCATGATTCTTCTGGCTTTCAGCTCCTGGAGTCTGTGCTCAGATTCAGAAGAGGAAATGAAAGCGTTAGAAACAGATTTACTGACCAATATGCATACATCAAAGATCAGTAAGGCAAGTGTTCCCTCTTGGAAAATGAGCCTGCTGAATGTCTGCAGTCTTATAAATAACCTGAACAGCCAAGCTGAGGAAACAGGAGAGTTTCATGAGGAGGAGCTCATTACAAGAAGGAAATTTCCTGCTGCCTTAGATGGTTTTAGCTTGGAAGCAATGTTGACGATATACCAGCTCCAAAAAATCTGTCACAGCAGGGCCTTTCAACACTGGGAGTTGATTCAGGAAGACATTCTTGATGCTGGAAATGACAAAAATGAAAAGGAAGAAGTGATAAAGAGAAAAATTCCTTACATTCTGAAACGGCAGCTTTATGAGAATAAACCCAGAAGACCCTACATACTCAAAAGAGGTTCTTACTACTAC