EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07302 alignment
(4 sequences with 669 bp)


AROM_ECOLI/4-225 TCGTTGGCGATCCTGACCATCGGCATTGTACCTATGCAGGAAGTTTTGCCGCTCCTGACGGAATACATTGAC---GAAGATAATATTTCCCATCATAGCCTGCTGGGGAAGTTAAGTCGTGAAGAAGTGATGGCGGAGTACGCGCCAGAAGCAGGCGAAGACACCATTCTCACATTATTAAATGACAACCAGCTGGCCCATGTTTCGCGTCGCAAAGTGGAGCGTGACCTGCAAGGTGTGGTTGAAGTGCTCGATAATCAGGGTTATGACGTCATTTTATTAATGAGTACAGCAAACATTAGTAGTATGACTGCGCGTAATACGATCTTTCTTGAGCCGTCGCGAATATTGCCTCCACTGGTTTCCTCTATTGTTGAAGATCATCAGGTGGGGGTTATCGTTCCGGTTGAGGAGATGCTGCCCGTTCAGGCGCAAAAATGGCAAATTTTGCAGAAATCGCCGGTATTTTCATTGGGTAACCCCATTCATGATTCAGAACAAAAAATCATTGATGCCGGGAAAGAATTACTGGCAAAAGGGGCTGATGTCATCATGCTGGATTGTTTAGGATTTCACCAACGTCATCGCGATTTACTGCAAAAACAGCTCGATGTTCCTGTCTTGCTGTCTAACGTATTGATTGCACGGCTGGCTGCGGAATTACTGGTG
Q8Z8Z0_SALTI/4-225 TCGTTGGCAATCCTCACAATCGGCGTTGTGCCAATGAGCGAAGTGTTACCGCTTCTGACGGAATACATCGAC---GAACAACACATAACCCATCATAGCCTGCTGGGAAAAATGAGCCGGGAAGACGTTATGGCGGATTACGCTGTAGAGCCTGGCGACGATCTGCTTTTGACGTTGCTGAATGATAACCAGATAGCCCATGTTTCCCGCCAGAAAGTGGAGCGAGATTTACAGAGCGTTGTCGAGGTGCTGGATAATCAGGGTTACGATGTCATTATACTGATGAGCACCGCGGCGATTAAAAGTACGGCAGCCCGTAATTCTATTTTGCTTGAACCGCTGCGTATTATTCCACCGCTTGTCGCCTCTATTGTGGATGGACATCAGGTGGGCGCGATTGTGCCTGTTGCAGAACTTCTGGCGGCCCAGGAGAAAAAATGGCAGGTATTGCAAATGCCGCCGGTGTATTCGCTGGCGAATCCGGTTCACGGTTCTGAGCAACAGTTAATTGATGCCGGGCAGGCGCTACTGGATCAAGGCGCGGACGTCATTATGCTGGATTGTCTGGGTTTTCATCAGCGTCATCGGGATATTTTACAGCAGGCGCTGGATGTGCCGGTTTTACTCTCTAATGTTTTGATTGCGCGGTTAGCTTCAGAACTGCTTGTC
Q89Q90_BRAJA/9-228 CGCATCGGGGTGGTCGTGATCGGCCAGAGCCCGCGCCCCACCGTCGCCTCCGAGATCGCTGCCGTGCTGTCGCCGGGCATCGAGATCGAGCTGCGCGGCGCGCTCGACGGCATGAGCCGCGCGGAGATC---GACGCCATCCCGCCGATGGACGGCTACGACACGCTGTTCACGCTGCTGCCGAACGGCGACGGCGTCACGATCAGCAAGAAGGAAGTCGAGCGCCGCGCAAGCCAGCAGATCACCCGCTTCAAGCACGAGGGCGTCGGCGTGACGCTGATGGCCTGCACCGGCAAGTTTCCCAACCTCGCGGCGGATGGC---CTCGTCATCCTGCCCTCGGCCATCCTGCACAATCTCGTCGAGGCCGTGCTGCCGAAAGGCCGGCTCGGCGTGTTCTCGCCGCTGCCCGAGCAGACCGTACTGATCGACAAGAAATGGCAGCGCGACGGCGTCGAGGTCGTCGGCATCACGCTGCGTCCC---GGTTCGAGCGACGCCGTCGTCGACGAAGCCGCACGCACGATGGCGGACCTCGAGCCCGATCTCGTGGTGATGGATTGCATCAGCTACACCAGCGCCAACAAGGCGCGCGTGCGCACGGCCTATCCGGGTCCCGCGATCCTCGGCATTGCCGCCGCGGCCCGCATCGTCGAGGAGCTGGTGTCG
O58748_PYRHO/2-217 AAAGTTGGCCTTATAACGATAGGTCAATCCCCAAGGATGGATGTCGTTCCGGAGATGAAACCTTATATGGAG---AGGGTTGGAATTGTTGAGTGCGGAGCTTTGGATGAATTAACCAGAGATGAAATT---GAGGAACTAGCTCCAAAAGAGGATGAGGAAGTTCTAGTCAGCAGGCTTAGGGATGGAAGTCAAGTTAAGTTAAGTAGGGATAAAATAGTGAAGAAGCTCCAGGAGTGCATTGATAAACTCGAGAAGGAA---GTTGATGCAATAGGACTTCTATGCACGGGAGAATTCCCAGAACTAAAGGCAAAGAAA---CTACTCATTGAACCTTCAATCCTTCTTTTAAAAACCGTTGAAGCC---CTGAACGTGTCTAAGCTAGGAGTTCTAGTACCGGATCCAAAACAGAAAGAAATGGCCAAGAGAAAGTGGAAGAAGGTTGTAAAGGAAGTCCAAGTGAGGAGCGTTTCTCCATACGTTGGAACCGAAGAAGAGCTAAGGAAACAAGCTCAAGATCTAGCGAGT------TCTGAGCTTATAGTTCTTGACTGCATAGGTTATTCAACTAGGTCAAAAGAGATAGTTAAAGAGGTTACAGGAAAACCCGTTCTTCTTCCTAGAACTTTGATGGCTAGGGTAATTGGGGAATTGGGGGAA