EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07130 alignment
(6 sequences with 225 bp)


Q8ZFD7_YERPE/1-75 ATGGCCGTTGAAATAAAATTCGTCGTGGTGAGACAGGGTGAGGAAAAAATGACTTTCACAACCAAAAAAGAAGCCGATGCCTACGATAAGATGCTGGATTTGGCTGACAACTTGTCTGAATGGTTATCACAGGCTCCGCTGTCGCTAGAGGAAGAACAACGTGAAGCGTTAAGTTTCTTCTTGGCAGAAAATAAAGAAGCATTAGGGCAAATTCTACGCGGTAGT
YEBG_ECOLI/1-75 ATGGCGGTTGAAGTTAAATACGTAGTCATTCGTGAGGGCGAAGAGAAAATGTCGTTTACCAGCAAAAAGGAAGCCGATGCTTATGACAAAATGCTTGATACGGCGGATCTGCTTGACACCTGGCTGACAAATTCTCCAGTGCAAATGGAAGACGAGCAACGTGAAGCCCTTTCGCTATGGCTGGCAGAACAAAAAGATGTGCTGAGCACCATTCTGAAAACCGGC
Q87M79_VIBPA/1-75 ATGGCTGTAATCGTCAAGTACGTGGTAGAACGCAATGGAGAAGAGAAAATGACTTTTACCTCTAAAGCGGAAGCTGACGCATACGACAAAATGCTGGATATGGCAGATGAACTATTCACACTGCTAGGTAAAAGTGAACTTCTAGAAGACGAAGGCAAGCAAGAAGATCTTGCGATGTTCCTTGCGCAAAACAAAGAAGAGTTGCTTTACGCAATCGGTGCAAAA
Q8EDY6_SHEON/1-75 ATGGCAGTTATTACACAGTTTGTCGTGGTAAGAGAAGGGGTAGAAAAGATGACATTCACATCGAAAAAGGAGGCTGATGCCTACGATAAGATGCTCGATATCGCTGACAACCTCATTCCATTTATTCAAAACGCGCAGCTCGGAATTGATGAAAGTCTGACCGAACAGCTCGCATTCTATTTTGCTAACAATAAAGATGAGCTGACAAACTTGCTTAAAGGCGTC
Q887T9_PSESM/1-73 ATGGCTGTTGAAACCCTTTACCGCAGTACCCGCGATCTGGAG------ACTACTTTCGTGGACCGTAAACTCGCCGATGCGCACGACCAAATGCTCGAGCTGGCCGAGCTTCTCACCGACGTCCTGATCAAGAACGTACCGGGGCTCTCGGAGAAGCATGCTGAGGATGCGAGCATCTATATGGCGAAGAATCGGGCCGTGTTTGCAGCGGCGTTCAAAAACAAC
Q88E52_PSEPK/1-73 ATGGCCGTCGAAGTGGTGTACCGCAGCAGCCGCGACCCGGAG------CGCTTGTTCATGGATAAGGCCGAAGCAGACCGTCACGACAAGATGCTCGAACTGGCCGAGCGCCTGGCCGAAGTGCTGCACAAGGCGGTGCCGTCGCTGACCGAGCAGCAGGTCGAGGAAGCCGGTATCTACATGGCGAAGAACCGCGATGTGTTCGCCCGGGCGTTCAAAAGCCAG