EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF07057 alignment
(4 sequences with 381 bp)


Q9ZA71_YEREN/1-125 GTGACATTGTCACGCGCCAAAGAGCATGTCCAGGTCTATACGGACAACGTTGTTAAATGGTCGGGTCTTGCCGCGCAGTCAAATACCGGAAAAACCGCGCATGAGCTGCTGCATCAGGACAGCGATCGGGAGGTTCTGACGGGGAACCGGTTGCTGGCCACTGCATCGCGGCTTGACAAGACGGCTCTGGGGCGGCGTGTCCTGAGCGAAAGCGGTCTGACTGGC---GAAAGCCTGGCTCGTTTTATTGGTGCCGGGAAAAAGTACCCGACACCGTATGTGGCACTGCCTGTTTGGACAAGGCATGGGCGTGAGGCGGGTGCCCTGTTGACTGAGATTCGTCTGGAGGAT---GATGGGGTACGTGTCGTACTGGGCGAA
Q8KNJ9_SALTI/1441-1565 GTGACGCTGTCACGAGCAAAAGAGCATGTGCAGGTCTATACCGACGATCTGGCTGGCTGGAGTGCTGATGCCCGGCACTCAAATGCCGGACAGACCGCTCATGACCTGCTGCACCAGAAAAGTGACCACGAATCCGACACCGGCAACAGACTGCTGGCCACTGCCTCACGTCTGGATAAAACCGCGCTGGGCCGCCGGGTACTGGCGGAAAACGGCCTTGAGGGT---GAAACAATGGCGCGCTTTATTGCTGCCGGTAAAAAATACCCGTCACCCTATGTGGCCCTGCCGGCCTGGACCCGTCACGGGAAAGCGGCCGGGGCGCTGCTGACTGAAATCCGCATCGAGGAT---GACGGAATGCGCGTGGTGCTCAGTGAT
Q93GL4_SALTY/1430-1556 GTGGCGCTGTCGCGTATGAAGCAGCATGTGCAGGTGTACACCGACGACCGTCAGGGTTGGGTTAAGGCCATCAACAGTGCGGAGCAAAAGGGCACGGCCCATGACGTGCTGGAGCCTAAATCAGAGCGTGAGATGATGAACGCAGAGCGCCTGTTCAGCACCGCCCGGGAACTGCGGGACGTGGCCGCCGGCCGTGCCGTGCTGCGCAACGCCGGACTGGCGCAGGGAGACAGCCGGGCGCGTTTTATTGCACCGGGGCGCAAGTATCCGCAGCCGTATGTGGCGCTGCCGGCGTTTGACCGTAACGGTAAATCCGCCGGTATCTGGCTGAACCCGCTGACAACGGATGACGGTGCCGGGCTGCGGGGATTCACCGGGGAA
O82919_ECO57/149-275 GTGGCCCTGTCGCGTATGAAGCAGCATGTGCAGGTGTACACCGATAACCGTCAGGGCTGGACGGATGCCATTAACAATGCCGTACAGAAAGGAACAGCCCACGATGTGTTTGAACCGAAACCGGACCGGGAGGTCATGAATGCAGAGCGGCTGTTCAGTACGGCGCGGGAGCTGCGGGACGTGGCGGCAGGGCGTGCCGTTCTTCGTCAGGCGGGGCTTGCCGGGGGAGACAGTCCTGCACGGTTTATTGCTCCGGGACGTAAATATCCACAGCCGTATGTGGCACTGCCGGCGTTTGACCGTAACGGCAAGTCTGCCGGTATCTGGCTGAACCCGCTGACCACGGATGACGGAAACGGGCTGCGGGGATTCAGTGGTGAA