EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06734 alignment
(8 sequences with 561 bp)


Q9WT04_9BETA/319-500 AATATCTTTATAAAT---------CATAAAAAAGAGATAATCTTTGATGCCGTGTTGGCGGATTACAGCTTGTCCGAAATACATCCCGAG...TATAACGGCACGTGTGCTATTGCTAAAGAGTATGACAGAAATCTTCAACTTGTGCCAATCAGTCGTAACAAATTCTGTGACATGTTTAATCCTGGATTTCGACCACTTGTCGCCAATGCAATGATATTGGTCAATGTATGCGAGGCTTTTGATGGTGAAAATAATCCTCTTAGACACTGTAATTTGGATCTGTGCGCCTTTGCTCAGGTCGTATTATTGTGTGTCCTGAGAATGACAGATAAACGCGGATGCCGCGAAGCTCAGCTATACTACGAGAAAAGGTTGTTTGCGTTGGCTAACGAGGCCTGTCGATTGAATCCTCTTAGATATCCATTTGCTTACAGGGATGCTTGCTGTAAAGTATTGGCTGAGCATGTAGTGTTGCTAGGG---TTATTGTTTTACCGAGACGTGGTTGATATATATGAAAAAATATACGATTTTCTAGATGAAAGAGGGGAATTTGGG
GCVK_HHV7J/302-483 AATATTTTGATACAC---------CACAAGGAAGGTATTATTTTGGAGGCTGTGTTAGCTGATTACAGTTTAGCTGAAGTACACCCACAG...TATAATGGAAAATGTGGAATACTAAGACAATTTGATCATAGGATCCAGATTGTGCCTAAAAGTTATAATAAATTGTGTGACATGTTTAATCCAGGTTTCAGACCCATGATAGCTCACAAAATAATTTTGGTCGAAGTTTATGCAGAATTTGATGGTAAGGGCAATCCAGTGAGACATTGTAATCTAGATCTTTGTGCACTAGCGCAAGTATTTTTATTATGTGTCATCAGAATGTTGGATGAACGCGGATGCCGTGAGGCGCAAAAATATTATGAAAATCGATTGTTCACGTACTCAAATGAAGCTTGTACTTTGAATCCAATCAAATACCCTTTAGAATATAAAGATGCTTGTTGCAAAGTTTTAGCTGAGCACTTAGTTTTATTTGGC---ATTCTTTTTTATCGTGAGGTGGTGGATATGTTTGAAAACTTGTATGACTTTCTGCACGCAAGTGGTGATTTAAGC
Q67670_9BETA/353-535 AACTGCCTGATCAAAGGTGACCCGTCCGCCCCGTATCGGATCGCGCGCGCCGCGCTGTGCGACTACAGCCTGACCGAGCCCCACCCGATG...TACAATCGCAGGTGCGCCGTGGTCCTCCAGGAGACCAAGACGCGCGCGCATGTTGCCGCACAGTCAGATAAGCTGTGCGAGTGCTACCATCCCGCGTTCAGACCCATCATCCTGCAGGCACGTGAGCGC---CGAGCCGACGGCTATTTTCCGTTCGAGGACTGG---GTCCAGTTCTGCGTCGCCGAGATCTGCGCGCTGGGCATGGTGGTGTGTTTCTGTCTCATGAGGACCTTGGACTGGCGCGGGGTGCCGACCGTCAGGCGCGGTGAGCGAGTCCCTCTGTTCCAGGCCACGCCGCTGGCCTGCGACGCCATGGAGAAGCAGGATCTGGCCGGGTACTCCAGCGCCTGTCTGGCCATCATGGCCAGGCAGCTGGCCTACGTCGGAGCGATACTCGGG---TCCCGCGTCTCGGATACGTTCGAGCGCACCAAACGTTTCGTGAAGGTTCAGTGCGGTGACGTA
Q91TK7_TUHV1/416-599 AACATCCTGGTCGTGCCGTCCCGGACCTGCCCGGGGGTGCTGGAGCACGCCGTGCTCTGCGACTACAGCCTGTCCGAGCCGCACTCGGAC...TTCAACCGGCGCTGCGTGGTCGTCTTCGAGCAGACCAAGACCGCCCGGGTGCTGGAGGACAGCCGGCAGCGGATCTGCGAGTGCTACCACCCGGCGTTCCGGCCGGTGCCGCTGCAGCGCATCGTGGTCATCAATCCGCACGCCACCTTCCCGGTCGGCGCGCGC---AACCGCTATTCCGTCGCCGAGCTCTGCGCGCTGGGGAACGTGGCGCTGTTCTGTCTCGCCCGCCTCCTGGACGAGCGCGGGGAGGATTTCGTCCGCTACAGCTGCGAGAACGCCCTGTTTCGGGTGGCCGGCTCGGCCTGCCGCGCGATGGAGGCCGACGACCTGCGGAGCTACTCGGACCGGTGCCTGCGCATCCTGGCGCACCAGCTGGCCTACATCCACGCCGTGCTGGGC---GACATGGCGAGCGGGATCGTGACCCGGACCCAGCGCTACGTCCAGGTGCAGTGCGATCCTATT
O71123_9BETA/363-547 AATGTGCTGATCAATGTCAACCCGCACTACCACAGCGAGATTCTCCATGTAGCGCTCTGCGACTACAGCCTCAGTGAGCCTTATCCCGTG...TGCAACGACCGTTGCGTGGTGGTGTTTCAAGAAACCGGTACGGCTCGGCGCATCCCCAACTGTACGCATCGGTTGCGCGAGTGCTATCACCCTGCCTTTCGACCCCTCCCTCTGCAAAAACTGATGATCTGCAATCCCCATGCACGTTTTCCCGTTAGCAATAGTCCGCGGCGCTTTTGTATGATCGAACTGGCCGCTCTGGGGAACGTGTTGGCCTTTTGCTTGGTACGACTGTTGGATCGCCGGGGAATAGAGGGTGTTCACAATGGCCCTGAGTCGCTGCTGTTCAAACACGCCGCGACTGCCTGTCACGCGTTGGAAAACAACCGCCTGACGGCTTGCTCCGACGCCTGTTTACTCATTATGGCCGCGCAGCTGTCTTATCACGCCGGCCTGTTGGGC---GACGACGGCCTTGCCGTCGTGAGCCAGACGGTTGGCTTTGTGGAAGCCAAGATGTCGTCCTGT
Q91B54_HCMV/461-644 AACGTGCTCATCGACGTGAACCCGCACAACCCCAGCGAGATCGTGCGCGCCGCGCTGTGCGATTACAGCCTCAGCGAGCCCTATCCGGAT...TACAACGAGCGCTGTGTGGCCGTCTTTCAGGAGACGGGCACGGCGCGCCGCATCCCCAACTGCTCGCACCGTCTGCGCGAATGTTACCACCCTGCTTTCCGACCCATGCCGCTGCAGAAGCTGCTCATCTGCGACCCGCACGCGCGTTTCCCCGTAGCCGGCCTA---CGGCGTTATTGCATGTCGGAGCTGTCGGCGCTGGGTAACGTGCTGGGCTTTTGCCTCATGCGGCTGTTGGACCGGCGCGGTCTGGACGAGGTGCGCATGGGCACGGAGGCGTTGCTCTTTAAGCACGCCGGCGCGGCCTGCCGCGCGTTGGAGAACGGCAAGCTCACGCACTGCTCCGACGCCTGTCTGCTCATTCTGGCGGCGCAAATGAGCTACGGCGCCTGTCTCCTGGGC---GAGCATGGCGCCGCGCTGGTGTCGCACACGCTGCGCTTTGTGGAGGCCAAGATGTCCTCGTGT
Q83249_9BETA/396-581 AACGTGCTCATCAACTATGACCGCGCCGACGACAGGCAGATCGCGCGTGCGGTCATCTGCGATTTCAGCCTGTCGCAGTGTCACACCGAGggtACTACCGGACACTGCGTCGTGGTCTTCCAGCAGACCAAGACCGTCAGGGCGCTGCCCAAGAGCGCCTACTACCTCACGGACATCTACCATCCCGCCTTCAAGCCGCTCATGCTGCAGAAACTCTGCGCCATCGAGCCGCGCAAGCAGTTCCCCAAGCCCTCGGCG---AACCGCTTCTGCGTCTCGGACCTCTGCGCCCTGGGACACGTGGCCGCTTTCTGCCTGGTCAGGGTCCTGGACGAGCGCGGACAGCTCAAGGTCAGGAGCACCTCCGAGGACGCGCTCTTCGGCGTCGCGCGCAAGACCTGCGACGCCCTCGCCCGGCACTCGGTGGACGAGGTGGCGAACTTTTGCTCGCTGCTCATCACGCGCCAGCTGGCCTACACCGCCACCTTGCTGGGCAGCGACGACATGCGGGAGCCTATGGCGCGGTTGTGTGACTATTTCGAAACGGTTAGCGACAAGGAC
Q9DWA3_RCMVM/366-550 AACATCCTCGTCCAGGTCGACCCCGAGGACGGGCGGCGTCTGCGGCGGGCGGTCCTCTGCGACTACAGCCTCGCGCAGTACAACGGGCCC...CACGACGATCGCTGCGTGGTGGTCTTCCAGCAGACCCGGACCGTGCGGGCGCTGCAGAGCAGCACCTACTACCTCACGGACCTGTACCATCCCGCGTTCAAGCCCCTGCCGCTCCAGAAGCTGTCGTGCGTCGAGCCGCGGGCGCGGTTTCCCCACCCGAGCGCC---CGGCGCTTCTGCGTCACGGACCTCTGCGCCCTGGGCAGCGTCGTCGCCTTCTGTCTCGTGCGGGTGCTCGACGACCGCGGCCTCCCCAAGGTCCGGGCCACGACCGAGAACGCGCTCTTCGCCGTCGCCCGGAAGACCTGCGAGGCCCTCGGACGACACGACGAGGACGCCGTCGCCAACTGGAGCTCGCTCCTGCTGACTCGGCAGCTGGCCTACGCCGTCTCCCTATTGGGCGTCGACGAGGCCCGGGAGGCCGTGGCCGACCTATGCCATTTCTTCGCCGCCAACGCGGATCACGAG