EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06339 alignment
(7 sequences with 390 bp)


ECTC_CHRSL/1-130 ATGATCGTTCGTAACCTGGAAGAATGCCGCAAGACCGAGCGCTTCGTCGAAGCCGAAAACGGCAACTGGGACAGCACCCGTCTGGTGCTGGCCGACGACAACGTCGGTTTCTCGTTCAACATCACCCGCATTCATCCGGGTACCGAGACGCATATCCATTACAAGCATCACTTCGAGGCGGTTTTCTGCTACGAAGGCGAAGGCGAAGTCGAAACGCTGGCCGATGGCAAGATCCATCCCATCAAGGCCGGCGACATGTACTTGCTCGATCAGCACGACGAGCACCTGCTGCGCGGCAAGGAAAAAGGCATGACCGTGGCATGCGTGTTCAATCCGGCGCTGACGGGCCGCGAAGTGCACCGTGAAGACGGTTCCTACGCACCGGTCGAT
ECTC_VIBCH/1-127 ATGATTGTTAGAACGCTAGAAGAGTGCCGCCAAAGTGAACGTCGAGTGGTGGCAGAAAAC------TGGGAAAGTGTGCGTATGTTATTGAAAGATGACCATATGGGGTTCTCTTTTCATATCACGACCATCTACGCCAACACTCAGACGCATATTCACTACCGCAACCACCTCGAATCGGTGTACTGCATGTCGGGTGAAGGCGAAATTGAGGTTGTGGGT---GGTAAAACGTATCCGATCCAACCAGGAACCTTGTACATCCTAGATCAACATGATGAACACTACTTGCGCGCTTTTTCTAGCGAGATGGTGATGGCGTGCGTCTTTAATCCGCCACTCACTGGACACGAAATTCATGATGCGGAAGGTGTCTATCCGCTGGATAAA
ECTC_BACHD/1-127 ATGAAAGTCGTTAAATTAGAAGATGTCATTGGAACAGAACAAGAAGTTAAAGGGGAGAAC------TGGACGAGTCGCAGACTGCTCTTAAAAAAAGATGGAATGGGCTATTCCGTCCATGACACTATCATTAAAGCAGGGACAGAAACGCACATTTGGTATCAGAACCACCTCGAAGCCGTGTACTGCATCGAAGGCGAAGGTGAAGTTGAGACAGTCAAAGACGGCAAAGTGTGGCCGATTAAGGCGAATGAAATTTACGCACTTGATGAGCACGACGAACATTTGCTACGCGCC---AAAACCGATATGCGTATGGTTTGCGTCTTTAACCCACCAATTACAGGGAAAGAGACCCATGATGAAAATGGTGTGTATCCGCTAGTCGAC
ECTC_BACPA/1-128 ATGATCGTTCGAACGATTGATGAAATCATAGGAACAGAAAATGAAGTGGAATCGGACACA------TGGACGAGTCGCCGTTTACTACTTGAAAAAGATGGCATGGGCTTTTCATTTCATGAAACGATTATCTATGCAGGTACAGAAACGCATATCCACTATCAAAACCATTTAGAAGCGGTGTACTGTGTCGGTGGAGATGGAGAGATTGAAACGGTCTCGGATGGAAAAGTGTATCCGATTCAAGACGGAACGATGTATGCATTGGATCAACATGATGAGCATTATCCCCGCGGGGGAAAAACGGATATGAGGCTAATTTGTACATTCAATCCACCGCTCGTCGGTACCGAAACACATGATGAAAATGGTGTGTACCCACTTCTTTCG
ECTC_MARHA/1-128 ATGAAAGTAATTAAACTCGAAGATTTGCTCGGCACTGAACGTGAAGTAGATGACGGCAAC------TGGGTGAGCCGCCGTTTCATCATGAAAGACGACAACATGGGGTATTCGGTAAATGACACAATTATTCGTGCCGGTACTGAAACTCACATCTGGTACCAGAACCATCTCGAAACCGTATACTGCATTGAAGGCGATGGAGAAATCGAAACTTTAAGCGACAATAAAGTATATCAGCTGGAACCAGGCGTATTATACGCACTCGATAAAAACGATGAACATATGCTTCGTGGAGGCAGCAAAGATATGCGTATGGTATGTGTCTTCAACCCGCCACTTAGCGGTCGTGAAGTGCATGACGAAAACGGTGTATATCCCGCTGATCTT
ECTC_OCEIH/1-127 ATGATCGTAAAATCATTAGAAGACATTCAAGGTACAGAGGATCATCAAAAAGGGGAAACA------TGGGAAAGCAGACGTTTTGTTTTAAATAAAGACAATGTTGGCTTTAGCCTTAACGATACGATTATTAAGGCAGGAACAGAAAGCTACTTCTGGTACAAAAATCATATTGAAGCAGTGTACTGCATCGAAGGTGAAGGGGAAGTAGAGAAAAAAGATACTGGTGAGGTATGGCAGTTGAAGCCAGGAACGATGTATCTTTTAAATGATAACGATAAGCACTATTTACGTGCA---AAAACTCAAATGCGTATGGTATGTGTGTTCAACCCTGCGTTAGTAGGAACGGAAACACATGATGAAGATGGGGTATACCCATTATTAGCT
ECTC_STRCO/1-129 GTGATCGTCCGTTCGTTCAAGGAGTTCGAAGGCACCGACCGGCACGTGAAGAGCGCGTCCGGCACCTGGGAAAGCACCCGGATCGTCCTCGCCAAGGAGAAGGTCGGCTTCTCCGTGCACGAGACGATCCTGTACGCGGGTACGGAGACGTCGATGTGGTACGCCAACCACATCGAGGCCGTCGTCTGCACCAAGGGCGACGCCGAGTTGACCGACCGCGAGACGGGGAAGACGTACCACATCACGCCGGGCACGATGTATCTCCTCGACGGCCACGAGCGGCACACGCTCAAGGTC---AAGGAGGACTTCCACTGCATCTGTGTCTTCAACCCGCCCGTCACCGGACGGGAGGATCACGACGAGAACGGCGTCTACCCGCTGCTCACC