EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06247 alignment
(5 sequences with 693 bp)


Q9NL20_PLAVI/1-231 TACCACAGCTTGCTGTTCCTTCTGGCCATCGTGCTTACTGTTAAGCACACCTTCGCAAAGGTCACCGCGGAGACCCAATGCAAAAATGGCTATGTAGTCCAAATGAGCAATCATTTTGAATGCAAATGCAACGACGGGTTTGTTCTGGCAAATGAAAACACTTGCGAGGAAAAACGCGATTGCACAAATCCACAAAATGTAAATAAAAACTGTGGAGACTACGCTGTGTGTGCAAACACCAGAATGAATGATGAGGAAAGAGCATTACGATGCGGCTGCATAATAGGGTACACCGTAATGAATGAGGTGTGTACTCCAAATAAATGTAACGGCGTTGTGTGTGGAAAGGGAAAGTGCATCTTAGATCCCGCTAATGTGAACAGCACCATGTGCTCTTGTAATATAGGAACCACATTGGATGAATCTAAAAAATGTGGAAAGCCAGGAAAAACTGAATGCACGTTGAAGTGTAAGGCAAACGAAGAATGTAAAGAGACTCAGAATTATTACAAGTGCGTTGCGAAGGGAAGCGGCGGAGAAGGCAGCGGTGGAGAAGGCAGCGGCGGAGAGGGCAGCGGCGGAGAGGGCAGCGGCGGAGAGGGCAGCGGTGGAGACACAGGAGCAGCTTACAGTCTCATGAACGGATCTGCAGTAATCAGCATACTACTTGTATTCGCCTTCTTCATGATGTCA
Q9GTZ5_PLACH/4-216 AAATACAGTTTTATTTTTTTATTTTTTATCCAACTTGCAATAAGATATACTAATGCAAAAGTCACTGTAGACACAATATGTAAAAATGGAAAACTAATTCAAATGAGTAATCATTTTGAATGTATATGTTCTCCTGGATTTGCATTAAAAACTGAAAACAATTGTGAACCAAGGGTTGCTTGTGATAAACTTGAAAATAAAGATAAAGTATGTGCTGATTATTCTACATGTGTAAACCAGGCA---AATGCTGTTCCAGCCGTTCTTAAGTGTGACTGTGTAAATGGATTTATAGCATCACAAGGTATATGTAAACCACAAAGATGTAATGGCGTCGACTGTGGTTTTGGAAAATGTGTACTCGATGGAGGAAACCCTAGCAACGCAACATGCTCATGTGATATAGGAAAAATTTTA---CAGAATGGTAAATGTACAGGTACAGGCCAAACCCAATGTTCATTGAAATGTAAAGCTCAAGAAGAATGCAAATTGAAAGGAAAATATTATGAATGTGTTGCCAAAGTCCCAGCCCCAGGTACTGGTGGAGGTGCAGGTACC------------------------------------------------GTAAAACCACCAGCCAGTGGTAGTTTTATGAACGGAACGTCAATACTCAGTATTATTGCATTATATGTTATGTATATAACAGTA
Q9GTY9_PLAVN/4-212 AAATACAGTTTTATTTTTTTATTTTTTATCCAACTTGCAATAAGATATAGTAATGCAAAAGTCACTGTAGACACAATATGTAAAAATGGAAAACTAATTCAAATGAGTAATCATTTTGAATGTTTATGTTCTACTGGATTTGTATTAAAAAGTGAAAACACTTGTGAGCCAAGTGTTATTTGTGATAAACTTGAAAATAAAGGTAAAGTATGTGGTGAATATGCTACATGTGTAAACCAGGCAAAT---GCTGCTCCAAACGTTCTTAAGTGTGAATGTTTAGCTGGATTTATATTATCACAAGGTGTATGCAAACCAATAAAATGTAATAACTTCGACTGTGCCGCTGGAAAATGTATAATCGATGGAGTCAAC---------CCAGTATGCTCATGTGATATAGGAAAAATTTTA---CAGAATGGTAAATGTACAGGTACAGGCCAAACTAAATGCTCATTGAAATGTAAAGCTCAAGAAGAATGCAAGTTGCAAGGAAAACATTATGAATGTGTTGCCAAAACCCAAGCACCAGGCACTGGTGGAGGTGCAGGTACA---------------------------------------------------ACCCCCCCAACAAATGGAAGTTTTATGAACGGAATGTCAATATTCAGTATTATTGCATTATTTGTTATGTATATAGCAGTA
OS24_PLABA/4-212 AAATACAGTTTTATTTTTTTATTTTTTATCCAACTTGCAATACGATATAATAATGCAAAGATCACTGTAGACACGATATGTAAAGGTGGAAAACTAATTCAAATGAGTAATCATTACGAATGTAAATGTCCTTCTGGATATGCATTAAAAACTGAAAACACTTGCGAGCCAATTGTTAAGTGTGATAAACTCGAAAATATAAATAAAGTATGTGGTGAATATTCTATATGTATAAACCAGGGAAATTTTGGCTTAGAAAAAGCTTTTGTATGTATGTGTACAAATGGATATATGTTATCACAAAATATATGTAAGCCAACAAGATGTTATAACTATGAATGTAACGCTGGAAAATGTATACTTGATTCTATTAACCCTAACAATCCAGTATGCTCATGTGATATAGGAAAAATTTTA---CAGAATGGTAAATGCACAGGTACAGGAGAAACTAAATGTTTATTGAAATGTAAAGCTGCAGAAGAATGCAAATTGACTGGAAAACATTATGAGTGTGTTTCCAAACCCCAAGCACCAGGTACT------------GGTAGC---------------------------------------------------GAAACGCCATCAAATAGCAGTTTTATGAACGGAATGTCAATAATCAGTATTATTGCATTACTTGTTATTTACGTGATAGTA
O00924_9APIC/4-226 AAATACAGTTTTATTTTTTTATTTTTTATCCAACTTGCGATAAGATATAATAATGCAAAAGTCACTGTAGACACGATATGTACAAATGGAAAACTAATTCAAATGACTAGTCATTTAGAATGTAAATGTATTCCTGGATATGGATTAAAAAATGAAAACACTTGTGAGAAAATTGTTAAGTGTGATCAACTCGACAATATAAATAAAGTATGTGGTGAATATGCTATATGTGGAAACCAAGCAACTTTGGGTTTAGAAAAAGCTCTTGTATGTTCATGTGTAAATGGATATTTATTATCACAAAATATATGTAAACCAACAAAATGTTTTAACTATGAATGTCCCTCTGGAAAATGTATACTTGATCCTAATAACCCTAACAATCCAACATGTTCATGTGATATAGGAAAAATTATG---CAGAATGGTAAATGTACAGGTGTAGGACAAGCCAAATGTGCATTGAAATGTAAAGCTACAGAAGAATGCAAGTTGGTTGGAACGTATTATGAATGTATTTCCAAAAACCCAGCACCAGGTACAGGCTCAGGTACAGGCTCA---GGTACAGGTTCAGGT---------ACAGGT---------AGTGGTACTGGAACACCAGCAAATAGTAGTATTATGAACGGAATGTCAATATTCAGCATTATTGCATTACTTGTTATTTATATAGCAGTA