EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF06048 alignment
(6 sequences with 909 bp)


Q93IE4_STAAU/1-300 ATG---ACT---AACATCATCTTTAGTGAATATCCATACTGGCTTACTGAAGATTCATGGTATGAAGTTATACCACCGAAAGGTAAAAATGATCAGCAAAAGTCCATACGCTTATCTAGTCCAATTTTAATTAAAAACAAGTTTCTTGACCCCAAATCTGGGGTTGAGAAACTAGTTATTTCCAACGGACAAAATATTGGACGTATTGAAACATCAGATATTTTAACATCGCAAAAGTTACCTTCACTAATCATGTATGGCTTCAGCATCAATGAGAAGTACATTAAATCATTAAGCAATGCACTACAATTAATGCGCCAATCACTGCCTCTGTCATCGTTGTATACGGGTGTCGGTGTGTTAAATACTGATAAA...GGTGTCGTCATTTCATTAGATGAACCATATCTTTCAAAAGAAATTACACAGTCGCAGGCGGATGAAATCATTTGTGAAACACAGTACGATCTACAACCTAAAGGCACTTTTGAAGACTGGTGGCAAATGTATCTTGATGAAGTAAAAGGAAACTTGTTACTCGAACTTGCTGTAGTGTTTGGTATTTCTTCATTAGTAACTGCGTTTTTAAAAACAAAACATGAGGTTGAATTCGCAGGTACGATTTTCTCATTTACGGGAAATTCAAGCACGGGTAAATCAACTGCAGCGGCTTTAGGAGTCTCAATAACCGGCAACCCTACTAAAGGTAGTAATACGCTGTTTAGATCATGGAATGGCACTAGAAACGCGCTTGAAGGATATCTAAGTAACAACTATGGTGTACCTATTGTATTGGACGAACTGTCATCTGCAACCTTTAAAGATACAACTGGTTTGCTCTATTCAATTGCCGAAGGTCAAGGAAGACAACGTTCTAATATACACGGAGAAGTCAAGTCACTAAAAAAC
Q8VUU9_STAAU/1-301 ATG---AAT---AACAACATATTCAAGCAATATCCATATTTTTTAAATTCAAATGGCTTTTATGAAGTGATTCCACCTAAAAGTAACAATGATGTAGAAAAAATCATTCAATTGTCTAGTCCCATCATTATTGAAAATAAATTTCTCGACCCGTCTACAGGGGTTGAGAAGTTAATTATTACAGATGGAAAAAATATTGAACGTATTGAAGCATCAGATATCTTAACATCTTTCAAGCTACCTGGATTGATTAAGTACGGCTTCAACATCAATGAACGGTACATTAAATCATTAAGCTATGCGTTACAATCGATGCGCCAGTCACTTCCATTATCTAAATTATATACCGGCGTAGGTGTATTACAGTCTGATGATgaaGGTATGGTCATTTCATTGGATAAACCATACTTTTCAAAAGAAATAGAGCAATCTCAAGCTAATGAAATCATTTGTGAAACACACTATGATTTACAACCAAAAGGTACTTTCAAAGGCTGGTGGGAGATGTACTTAAAACAAGTTAAAGGGAACTTACTACTAGAACTTGCTGTAATATTTGGTATTTCTGCCTTAGTGACAAGTTTTCTGAGGCACAAACATGCAACCGAATTTGCCGGAATCATTTTTAGTTTTACAGGTCAATCCTCAACCGGTAAGTCAACTGCAGCTTCTTTAGCTGTATCAGTCGCTGGTAACCCTACCAAAGGTAATGAAACTCTTTTTAGAAGTTGGAATGCCACACGAAACGCACTTGAAGGTTACTTGAGTAACAATTATGGCATACCTATTGTATTTGACGAACTCTCGTCAGCAACTTTTAGAGATACAACGGGGTTATTGTACTCCATCACTGAAGGTCAAGGTCGTCAACGTTCAAACGTTCATGGAGAAGTTAAAACGCCTAAGAAT
Q8CU73_STAEP/1-302 ATGGCTCAAACTAACCTTTCATTTAATCCTTCACCACGATACAAATCAAAAAAAGGTTGGTATAAAGACACGCCCCCAAAAGAAAAAGGAGGAATGCCTACTGAAGTTGAAATCGCAGGTCCTATCGTTATCGAAAATAAGTTTATTGACCCTAAAACTAATACTGAAAAACTAATTATCACAGACGAAGATCAAAAAGAAATTGTTGAATCTAGTGATATTTTAACGACACAAAAACTGCCATCTTTAATGAAGTATGGATTTAGTATTAATGAAAAATATACAAAAGATTTAGGTTATGCGTTGCAACAAATGCGCAATCAATTACCCATTTCCTACTTATATGAAGGGGTAGGTATACTGGAAACACCGTTT...GGTCCTATTGTATCGTTAAGTGAAATCTATACTACTAAAGAATTTGATAATAAATCTCCATCTGACGCCATTTGTGATAATGCTTATGACTTAACTCCTAAAGGTACATTTGATAATTGGTTTAACATGTATCTAAAAGAGGTTAAAGGTTCTCTTCTTTTAGAATTAGCAGTCGTATTTGGTATTTCTGCCTTAGTGACGAGTTTCCTGAAGCACAAACATGAAACCGAATTTGCCGGAATCATTTTTAGTTTTACAGGTCAATCCTCAACCGGTAAGTCAACTGCAGCTTCTTTAGCTGTATCAGTCGCTGGTAACCCTACCAAAGGTAATGAAACTCTCTTTAGAAATTGGAATGCCACACGTAATGCACTTGAAGGTTACTTGAGTAACAATTTTGGTATACCTATTGTATTTGATGAACTCTCATCAGCAACTTTTAGAGATACAACGGGGTTATTGTACTCCATCACTGAAGGTCAAGGTCGTCAACGTTCAAACGTTCATGGAGAAGTTAAAACGCCTAAGAAT
Q8VUX3_STAHO/1-301 ATG---AGTCATCATGACATTTTTAGACTAGGCCTATACCATTTAGATACAATGGGTTGGCATAAAACTATTCTACCTAAAAAAGATGGAGATGAGAAAAAAGTGGTGACTATGTCTAGTTGTATCGCTGTTGAAGCTAAATTTTGGCATGCCTCAGAAAATACAGAAAAGATAATTATTTCTAACGGTAAAGATAAAGAACATACATTTGAATCTGATATTTTAACAGCTCGAAAGTTACCTTCCTTGATTAAATATGGTCACAGTATCAATGAAAATTATATAAAAGATTTGAGCTATGCACTACAATTAATGCGCGATGAACTGCCCACTTCTGATTTATATGATGGCTCGGGCATTATAGAAACACCCCAC...GGTTATATTGTAATGATAGATACCATTTATACATCTAAACAATATGATCAATTATCATCTTTAGATCCTATTGTCGATAGTGCTTATCCATTAGAGCCTAAAGGTACATTTAAAGATTGGTTAAATATGTATATTAACGAAGTCAAAGGTCATCTTCTTCTAGAGTTAGCGGTCGTATTTGGAATTTCTGCCTTAGTGACAAGCTTTCTGAAGTACAAACGTGAAATCGAATTTGCAGGAATTATCTTTAGTTTTACAGGCCAGTCATCAACTGGTAAATCAACAGCAGCAGCTTTAGCAGTATCCGTCGCTGGAAATCCAACTAAAGGTAATCAAACACTTTTTCGAGGTTGGAATGCCACACGTAATGCACTTGAAAGTTACTTGAGTAACAATTTTGGTATACCTATTGTATTTGATGAACTCTCATCAGCAACTTTTAAAGATACAACGGGGTTATTGTACTCTATCGCTGAAGGTCAAGGGCGTCAACGTTCCAATGTACACGGAGAAGTTAAAACGCCTAAGAAT
Q8VUV5_STAAU/1-300 ATG---AGT---TACACATTGTTTGAAATTGGCCCATTTGCTTTAGATTCCTTCGGTTGGAAAGAAACGATACCACCTAAAAAAGATGGTGACAGTGAAAAAGTGGTTAGAATGGCTAGCCCTATTATTGTTAATGCAAGATTTTCTGATCCAATTACTGGTGTTGAAAAGTTGATTATTACTAACAACAATGGTAAAAAAGACATTTTTGAGTCTGATATCTTAACAACACGAAACTTACCTTCTTTAATTAAATATGGCTACAGTATTAACGAGAAGTATATTAGATCATTGAGTTATGCCTTGCAATTGATGCGAGATAGATTACCACTTTCTGAATTATATGAGGGTGTAGGTATACTAGAGACACCTTTT...GGCTACTTGATATCGCTAGATAAAGTTCTCAAATCTATTCAATTTAATCAGTCCTCACCTTCATACCCTATTGTAGATAGTGCTTATGACTTAACTCCTAAAGGTACATTTGATAATTGGTTTAACATGTATATTGACGAGGTTAAAGGTCATCTTCTTTTAGAATTGGCAGTCATATTTGGGATTTCTGCCTTAGTGACAAGTTTTCTGAAGCATAAACATGAAATCGAATTTGCAGGAATTCTCTTTAGTTTTACAGGTCAATCCTCAACCGGTAAGTCAACCGCAGCTGCTTTAGCTGTATCAGTCGCTGGTAACCCTACCAAAGGTAATGAAACTCTTTTTAGAAGTTGGAATGCCACACGAAACGCACTTGAAGGTTATTTGAGTAACAATTATGGCATTCCTATAGTATTTGATGAGCTTTCATCTACGACACTTAGAGATACCACGGGTTTGTTATATTCCATCGCTGAAGGTCAAGGTCGTCAACGTTCAAACGTTCATGGAGAAGTTAAAACGCCTAAGAAT
Q99XD2_STAAM/1-300 CTGTTAATGGAAAAAATTCTATATCAAACTGACGAATTCAAGCTCAAACCTTCGGGATGGTACAAAACCATCCCTCCTAAAAAAGATGGGGGTACGGAGTTTGAAATAATGTTATCTGGACCGATTGCTTTCACAGATCGTTTTATAGACCCCGCGACTCGTAAAGAAAAAGTATTTCTTTCGGATTTGAATAATATAGAGCTTGTCGAAAAGGCTTCAATCCTTACTGCTTTGCAATTACCCTCCTTAATTGAATATGGATTTACCATTAATGAAAAGCACATTAGAGATTTAGGGTTCGTACTGCAACAAATGAGAAGCACCACACCTTTATCAACAATATACTCAGGTGTAGGAATGCTTCATACATTACTT...GGACCATTAATTTCATTAGACCAGCCTTATTTTTCTAATGAGATTACTAATAGCACTTCT------ATTATATGTGATAACAAGTACGATTTAATACCAAAAGGCAATTTATCAGAATGGTTACAAATGTATAAAGAAGAAGTCCATGGGAACTTATCTTTAGAACTAGATGTGTTGTTTGGCGTATCTTCATTAGTCACTGCTTTCCTTAAGTATCATAATAACGTCGAGTTTTCAGGAACTATTTTCTCTTTCACTGGCCAATCATCAACAGGAAAATCGACAGCCGCTATGTTAGCCGCATCGGTAGCTGGCAACCCAACAAAAGGTACTGAAAACCTATTCCGGAGTTGGAATGCAACAAGAAATGCACTAGAAGGATATCTTAGCGGAAATTATGGTGTACCCATAGTATTAGATGAATTATCAGCGGCAACATTTCATGATACAACAGGTCTTCTATATTCATTTGCAGAGGGACAAGGACGTCAAAGAGCAAATATAAATGGTGATGTCAAAACACCTAAAAAC