EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05672 alignment
(3 sequences with 579 bp)


Q9HBQ2_HUMAN/244-403 TCACCCCCAGCCCCTGCTCCCCCGGTGACCCCTAGCAAACCAATGGCCGGCACCACAGACCGAGAAGAAGCCACTCGGCTCTTGGCTGAAAAGCGGCGCCAGGCCCGGGAGCAGCGGGAGCGCGAGGAGCAGGAGCGGAGGCTGCAGGCAGAAAGGGACAAGCGAATGCGAGAGGAGCAGCTGGCACGGGAGGCCGAGGCCCGG---GCGGAGCGGGAGGCGGAGGCCCGGAGGCGGGAGGAGCAGGAGGCACGAGAGAAGGCGCAGGCC---------------------------------------------------------------------------------------GAGCAGGAGGAGCAGGAGCGG------CTGCAGAAGCAGAAAGAGGAGGCCGAAGCTCGGTCGCGGGAAGAGGCGGAGCGGCAGCGTCTGGAGCGGGAAAAGCACTTCCAGCAGCAGGAGCAAGAGCGGCAAGAGCGCAGAAAGCGTCTGGAGGAGATCATGAAGAGGACTCGGAAGTCAGAAGTTTCTGAAACC---AAGAAGCAGGACAGCAAGGAGCGC
Q14244_HUMAN/456-626 GCCCCGTCATCCACTGTGAATGCCAGTGCTTCTGTTAAGACTTCTGCAGGCACCACCGACCCAGAGGAGGCCACAAGGCTTCTAGCTGAGAAGAGGCGGCTGGCCCGAGAGCAGAGAGAAAAGGAAGAAAGGGAGAGGAGGGAGCAGGAAGAGCTTGAAAGACAAAAGAGAGAGGAATTGGCTCAACGTGTGGCTGAAGAGAGGACGACTCGCCGTGAGGAGGAGTCGCGCAGGCTGGAAGCCGAGCAGGCCCGGGAGAAGGAGGAGCAG------------------------------------------CTGCAGCGGCAGGCGGAGGAGCGG------------GCGCTGCGCGAGCGGGAGGAGGCAGAGCGC------GCCCAGAGGCAGAAAGAAGAA---GAAGCTCGCGTTCGTGAAGAAGCAGAGAGGGTCCGGCAGGAACGAGAGAAGCATTTCCAGAGAGAAGAGCAAGAGCGCCTGGAGAGAAAGAAGCGACTTGAGGAGATTATGAAAAGAACCAGGAGAACAGAAGCTACAGATAAG---AAAACCAGTGATCAGAGAAACGGT
Q96T17_HUMAN/377-568 GCAGGAGGGAAAGCCGAAAACAGCGCAGCCTTGGGGAAGCCCACAGCAGGCACCACTGATGCAGGAGAGGCTGCGAAGATCTTGGCTGAAAAGAGAAGACAGGCCCGGCTGCAGAAGGAACAGGAGGAGCAAGAACGAGTGGAGAAGGAAGAACAAGATAGGCTGGAGAGAGAGGAATTGAAAAGAAAGGCAGAGGAGGAAAGG---CTTCGCCTAGAAGAGGAAGCCCGAAAGCAGGAAGAAGAAAGGAAGCGGCAGGAAGAGGAAAAGAAAAAACAGGAAGGGGAAGAGAAAAGAAAGGCAGGCGAGGAGGCCAAGCGGAAGGCTGAGGAGGAGCTGTTGTTGAAAGAAAAGCAAGAACAAGAAAAACAAGAGAAAGCCATGATTGAAAAGCAGAAAGAAGCAGCAGAAACAAAGGCCCGGGAGGTAGCTGAACAGATGCGTCTCGAGAGAGAACAGATTATGCTGCAGATTGAGCAGGAGAGACTGGAGAGAAAGAAGAGAATAGATGAAATCATGAAGAGAACAAGGAAAAGTGATGTGCCTCCACAAGTGAAGAAAGAAGACCCCAAAGTGGGG