EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05539 alignment
(3 sequences with 1248 bp)


Q9DXA1_TRTV/1-389 ATGGGGGCAAAACTGTATGCAATCTCAGGCGCCAGCGATGCCCAGTTAATGAAGAAAACTTGTGCCAAACTGCTTGAAAAGGTAGTTCCAATCATTATCCTTGCAGTGCTCGGGATAACAGGTACAACCACAATTGCACTGTCCATAAGCATCAGCATCGAGAGGGCAGTGCTGAGCGATTGT---ACAACCCAGCTAAGAAATGGAACCACTTCAGGAAGTCTTAGCAACCCAACAAGATCAACAACATCGACTGCGGTTACAACAAGAGATATTAGAGGACTACAAACGACTAGAACAAGAGAGCTTAAGAGCTGTAGCAATGTGCAAATTGCTTATGGTTATCTGCATGACAGCAGTAATCCTGTATTGGATAGCATTGGTTGTCTGGGCTTACTGGCTTTATGCGAATCAGGGCCTTTTTGTCAACGAAATTATAACCCACGAGATAGGCCAAAATGTAGATGCACATTAAGAGGTAAAGATATATCTTGTTGCAAAGAACCGCCAACAGCAGTCACCACCAGTAAGACCACTCCCTGGGGGACAGAAGTC------CACCCCACCTATCCAACCCAAGTGACACCCCAAAGCCAGCCAGCCACCATGGCACACCAAACA------------GCCACAGCAAACCAAAGGTTATCCACAACAGAGCCAGTGGGGAGCCAAGGAAACACAACCTCCAGCAATCCGGAACAACAGACAGAACCCCCACCAAGC---------------------CCCCAGCACCCCCCAACCACCACGAGCCAGGATCAGTCGACCGAGACAGCGGACGGCCAGGAGCACACACCAACCAGAAAAACACCCACCGCCACCAGCAACAGAAGGAGCCCA------------------------ACGCCAAAAAGGCAGGAGACAGGAAGAGCCACCCCCAGGAACACCGCGACAACCCAAAGCGGGAGCTCCCCCCCACACAGCAGCCCGCCCGGAGTGGACGCAAACATGGAAGGGCAG---------------TGCAAGGAGTTACAAGCTCCCAAGCCGAACAGTGTTTGTAAGGGGCTAGATATATACAGAGAAGCTCTTCCAAGGGGCTGTGATAAGGTGTTACCTTTATGCAAGACATCAACAATTATGTGTGTGGATGCCTATTACAGCAAACCACCAATTTGCTTTGGCTATAACCAGCGCTGCTTTTGTATGGAGACATTTGGGCCAATTGAGTTTTGTTGTAAGAGT
Q65302_TRTV/1-391 ATGGGGTCCAAACTATATATGGTTCAGGGCACCAGTGCATATCAAACTGCAGTGGGGTTCTGGCTGGACATCGGGAGGAGGTACATATTGGCTATAGTCCTATCAGCTTTCGGGCTGACCTGCACAGTCACTATTGCACTCACTGTTAGCGTCATAGTTGAACAGTCAGTGTTAGAGGAGTGC---AGAAACTACAATGGAGGAGATAGAGATTGGTGGTCAACCACCCAGGAGCAGCCAACTACTGCACCAAGTGCGACTCCAGCAGGAAATTATGGAGGATTACAAACGGCTCGAACAAGAAAGTCTGAAAGCTGTTTGCATGTGCAAATTTCTTATGGTGATATGTATAGCCGCAGTGATACTGTACTGGGTGGTTTTGATTGTATGGGCTTATTGGTTCTTTGCAAATCAGGACCAATTTGTCAGCGAGATAATCAAGTTGACCCAACAGCCCTCTGCCACTGCAGGGTAGATCTTTCAAGTGTGGACTGCTGCAAGGTGAACAAGATTAGC---ACTAACAGCAGCACCACCTCTGAGCCCCAGAAG------ACCAACCCGGCATGGCCTAGCCAAGACAACACAGACTCCGATCCAAATCCCCAAGGCATAACCACC------------AGCACAGCCACTCTGCTCTCAACAAGCCTGGGCCTCATGCTCACATCGAAGACTGGGACACACAAATCAGGGCCCCCCCAAGCCTTGCCGGGGAGCAACACCAACGGAAAAACAACCACAGACCGAGAACTAGGGTCCACAAACCAACCAAATTCAACCACT---AATGGGCAACATAATAAACACACCCAACGAATGACACTCCCGCCAAGTTACGACAACACAAGAACTATCCTCCAGCACACAACACCCTGGGAAAAGACA------TTCAGTACATACAAGCCCACACACTCTCCGACCAACGAA---------------------------------------TCAGATCAATCCCTCCCCACAACTCAA---AACAGCATCAACTGTGAACATTTTGACCCCCAAGGCAAGGAAAAAATCTGCTACAGAGTAGGTTCTTACAACTCCAATATTACAAAGCAATGCAGAATTGATGTGCCTTTGTGTTCCACTTATAACACAGTGTGCATGAAAACATACTATACCGAACCATTCAACTGTTGGAGGCGTATCTGGCGTTGCTTGTGTGATGACGGAGTTGGTCTGGTTGAGTGGTGTTGCACTAGT
Q65305_TRTV/1-413 ATGGGGTCAGAGCTCTACATCATAGAGGGGGTGAGCTCATCTGAAATAGTCCTCAAGCAAGTCCTCAGAAGGAGCCAAAAAATACTGTTAGGACTGGTGTTATCAGCCTTAGGCTTGACGCTCACTAGCACTATTGTTATATCTATTTGTATTAGTGTAGAACAGGTCAAATTACGACAGTGTGTGGACACTTATTGGGCGGAAAATGGATCCTTACATCCAGGACAGTCAACAGAAAATACTTCAACAAGAGGTAAGACTACAACAAAAGACCCTAGAAGATTACAGGCGACTGGAGCAGGAAAGTTTGAGAGCTGTGGGTATGTGCAAGTTGTTGATGGTGATATGCATGATCGCAGTTATGCTGTACTGGGTGGTGTTGATTGTTTGGGCTTATTGGCTCTTTGTGAATCAGGACCAATTTGTCAGGGAGATACTTGGTCTGAAGACGGAAACTTCTGCCGATGCACTTTTTCTTCCCATGGGGTGAGTTGCTGCAAAAAACCCAAAAGCAAGGCAACCACTGCCCAGAGGAACTCCAAACCAGCTAACAGCAAATCAACTCCTCCGGTACATTCAGACAGGGCCAGCAAAGAACATAATCCCTCCCAAGGGGAGCAACCCCGCAGGGGGCCAACCAGCAGCAAGACAACTATTGCTAGCACCCCTTCA------ACAGAGGACACTGCTAAACCAACGATTAGCAAACCTAAACTCACCATCAGGCCCTCGCAAAGAGGTCCATCCGGCAGCACAAAAGCAGCCTCCAGCACCCCCAGCCACAAGACCAACACC---AGAGGCACCAGCAAGACGACCGACCAGAGACCCCGCACCGGACCCACTCCCGAAAGGCCCAGACAAACCCACAGCACAGCAACTCCGCCCCCCACAACCCCAATCCACAAGGGCCGGGCCCCAACCCCCAAACCAACAACAGACCTCAAGGTCAACCCAAGGGAAGGCAGCACAAGCCCAACTGCAATACAGAAAAACCCAACCACACAAAGTAATCTTGTTGACTGCACACTGTCTGATCCAGATGAGCCACAAAGGATTTGTTACCAGGTAGGAACTTACAATCCTAGTCAATCGGGAACCTGCAACATAGAGGTTCCAAAATGTTCCACTTATGGGCATGCTTGTATGGCTACATTATATGACACCCCATTCAACTGCTGGCGCAGGACCAGGAGATGCATCTGTGATTCCGGAGGGGAGCTGATTGAGTGGTGCTGTACTAGT