EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF05105 alignment
(13 sequences with 438 bp)


VG14_BPB03/8-131 ACAAAACACGTGTTGGAATCTGATGATACAAAGCTAATATAC------TGGTTGACGTTGTTAATGGTTTGCATGATTGTTGATACTATTCTAGGCATTGTGATTGCGAGAATCAATCCTAAAGAGAAGTTTTCTTCATTTAAAATGAAAACAGGTATCTTGATCAAGGTTAGTGAAATGATTATCGCTCTATTAGCTGTTCCTTTTGCGTTACCGTTTCCTGCT------GGATTACCTTTATTGTACACTGTTTACACT---------------------------------------------GCTTTATGTGTGTCAGAAATGTATTCTATCTTTGGGCATTTAAGAGTTGTGGACGATAAAAGCAAT---------TTCCTTTCCATTATTGAGGGATTCTTTAAGCAGACATATAGAAAAGATAAAGGAGAT
VG14_BPPZA/7-130 ATGCAACACTTTTTGGAAACGGACGAGACAAAGCTAATCTAC------TGGCTAACATTCCTTATGGTTTGTATGGTTGTTGATACAGTACTGGGCGTCCTATTTGCAAAGCTTAACCCGAACATTAAATTTTCGTCATTCAAAATCAAAACAGGGGTATTAATTAAAGTTAGTGAAATGATTCTAGCGTTGTTGGCTGTTCCGTTCGCTGTTCCTTTCCCTGCG------GGTCTACCTCTATTATACACGGTTTATACG---------------------------------------------GCTTTGTGTGTATCGGAAATATATTCTATTTTCGGTCATCTGAGATTAGTTGATGATAAGAGTGAC---------TTTCTTGAAATACTTGAAAACTTCTTTAAACGTACATCCGGTAAAAATAAGGAGGAC
Q9FZW1_BPGA1/5-133 TTTCATTCGTTAATGGAAACGGATGACACAAAGGTATACTTT------CTATTAGGGATAATTGGTGTTTTGAACATAGTAGACTTCTTTTTTGGGTTTATAAACGCTAAATTTAATAAATCTATAGCTTATAAATCTAGTAAAACAATAGATGGTATAATGAGAAAAATGAAATTTACTATCATGGCAATTCTGTTTATACCTGTAAGTGTTCTAATGCCTGAACCGATCGGTCTTGGAGCACTATATGTTTTCTACTTT---------------------------------------------GGTTACATTTATGCAGAGTTAAATAGTATTTTATCACACTTGAAACTAAGTGAAGACGGTAAAGAAACAGAAGTATTTTTGGATTTTATTAACACTTTCTTTAATTCTACTAAAGGAGATAAAAAAGATGAC
VLYS_BPPH1/8-130 TTACAGATCGCAAGAGCATATCTTTTTGGGGAGGTGAAATAT---------CTTGATTTAATGCTGGTGCTGAACATCATTGACATCATTACCGGTGTGATAAAAGCATGGAAATTCAAG------GAGCTTCGGAGCCGCAGCGCATGGTTCGGATATGTGCGTAAGATGCTTAGTTTTCTCGTGGTTATCGTGGCGAATGCTATTGATACGATTATGGATCTGAAC---GGCGTCCTGACCTTTGCGACCGTTCTT------------------------------------------------TTTTATATTGCAAATGAGGGCCTGTCCATCACAGAAAACTTGGCGCAGATCGGCGTTAAAATTCCG---GCCGTCATCACTGACCGGCTTCATGTAATTGAAAGCGACAACGATCAGAAAACAGAAAAAGAC
YQXH_BACSU/13-135 TTAGATTTAGCAAGAGTATATTTATTTGGAGGGGTGAAGTAC---------CTTGATTTACTTCTAGTACTTAGCATAATTGACGTTTTAACAGGAGTAATCAAGGCATGGAAATTCAAA------AAACTGCGAAGTCGAAGCGCATGGTTTGGCTATGTCCGCAAGCTACTCAATTTCTTTGCGGTCATTTTAGCAAACGTGATTGATACAGTACTCAATTTGAAC---GGTGTCTTAACCTTTGGTACCGTTCTT------------------------------------------------TTTTATATCGCTAATGAAGGTTTGTCAATAACTGAAAACTTAGCACAGATTGGTGTTAAAATACCA---TCATCAATAACAGATCGATTACAAACAATTGAGAACGAAAAAGAACAGAGTAAGAATAACGCA
Y965_BACHD/12-133 CTTGCAGCTGCTGTCTCTTTTTTATATGGGGAGTGGACAATT------TTGCTATCAATTTTACTTACATTAGTGGTCATTGATTATGGCACGGGGCTAGTAGCAGCTGGCGTAACCGGA------AATATTAACAGTCGTGTCGGTCTTATAGGGATTACGCGCAAGGTTTTTATTTTCGTTATGGTGGCAATTGCCCACATGATCGATACTGTTCTGCTAGAGGTC---GGAATTGAAACAGAGGCTTTAATTTTTATG---------------------------------GCCGCCGTTGTTTTTTATATCGTGAACGAACTTATTAGCATCTTCGAAAATGCTGGTCGAATGGGACTACCGGTACCA------------------------AAGCAATTGAAACAGGCGATTTCCATTTTAAAAGGAGATGAA
Y1842_CLOAB/9-125 ATGCAAGATATGTCCAGCTACATGTTTGGTCAGTGGGATACC------CCTTTAATGGTTCTAATATTTTTTATGGTAATAGATTATTTAGGGGATATAGTAAATGCAGCCGTAGAAAAG------AGTTTGGATTTCAAAAAAAGTTACATGGGTATTGCAAAAATAGTATCTGTATTAGTGGTTATTATAGTATCTGTTCTAATGGATAGACTTGTTAACAAAGGAACATGGTTTTTTAGAACATTTACATGTTAT------------------------------------------------TTTTACGTAGCAAATGAAGGCATAAATATTTTAGAAAACTGCAGTAAATTAGGGCTTCCTATGCCG---GAAAAACTTATGAAAACTTTAGAGGATCTAAAAAATAGA------------------------
YNGD_CLOPE/15-132 TTAGGAACTTTATTCACTTGGATATTTGGTGCATGGGATATT------CCACTAATAACTTTATTAGTATTTATTTTTTTAGATTATTTAACTGGGGTAATTAAGGGGTGTAAAAGTAAG------GAATTATGTTCGAATATAGGATTAAGGGGAATAACTAAGAAGGGTCTTATATTAGTTGTTCTTTTAGTTGCTGTTATGCTAGATAGATTACTAGATAATGGA---ACTTGGATGTTTAGAACACTTATAGCTTAT---------------------------------------------TTCTATATAATGAATGAGGGTATAAGTATATTAGAAAATTGTGCAGCCTTAGGAGTACCTATACCT------------------------GAAAAATTAAAACAAGCGTTGAAACAGTTAAATAATAAAAAA
YTKC_BACSU/14-134 AGCGTTTCAGCAGCGGGTTTTTTCTTTGGAGGTTTTCAGTAT------TCATTTCTGATTTTGCTCTCTCTTATGGCAATTGAATTTATCAGTACGACTTTGAAGGAAACCATTATTCAC------AAACTGTCATTTAAAAAGGTATTTGCCCGGCTTGTCAAAAAATTAGTCACGCTGGCTCTGATCTCTGTATGCCACTTTTTTGATCAGCTGCTGAATACACAG---GGATCAATTCGTGACTTGGCTATTATG------------------------------------------------TTTTATATTCTTTATGAATCTGTGCAAATTGTTGTGACAGCCAGCTCTCTTGGCATACCGGTTCCT---CAGATGCTTGTCGATCTTTTAGAAACGTTAAAAAATAAATTTAAGCGCAAACCG---------
O21980_9CAUD/1-56 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGCACTTA------GGAAGCGTGATAGACACTTTCATATAT------------------------------------------------GCCATGATGGCTGCATACGGTTCAAGTATATTGGCTAACCTGTCATCTTTGGGAGTTAAATTCCCTTACATAGACAGGTATATTCGATTAAACATCGATAAAGAAAAATTCATCCTATTAGATGAAGAAGAG
VLYS_BPCP1/1-123 ATGTTATATAATATTATGCTAGAAGTTGCTAAAGGCGACTAT---------ATCACAATTCTTTTTGCTTTGATTCTGTTTGACTTTATCACAGGCTTTTTAAAGGCTTGGAAGTGGAAA------GTGACCGATAGCTGGACAGGGTTAAAAGGAGTTATCAAACATACCCTAACATTTATTTTTTACTATTTTGTAGCGGTATTCTTAACATATATTCACGCTATGGCAGTCGGTCAGATTTTGCTTGTTATCATTAAC------------------------------------------------------TTGTACTATGCACTTTCAATTATGGAAAATCTTGCTGTTATGGGTGTCTTTATCCCTAAATTTATGACGGCTAGAGTACAGGAAGAATTGCAGAAATACACCGCACAACTAGACGCAGGAAAA
Q9ZIB0_CLODI/20-163 CTAGGGGGCGTTATGAATATGACAATATCTTTTTTATCAGAGCATATATTTATAAAGTTAGTAATTTTAACTATATCATTTGATACATTATTAGGATGTTTAAATGCAATAAAAAGTCGT------AAATTCAATTCTAGTTTTGGAATAGATGGAGGAATCAGAAAAGTAGCAATGATAGCATGTATATTTTTTTTATCAGTAGTTGATATTCTTACAAAGTTTAACTTTTTATTTATGTTACCACAAGATTGTATCAATTTTTTAAGACTACAACATCTTGGAATATCTGAATTTTTCTCTATTTTATTTATTTTATATGAAAGTGTAAGCATATTAAAAAATATGTGCTTATGTGGATTACCAGTACCTAAGAGATTAAAGGAAAAAATAGTAGTTTTACTAGATGCAATGACAGATGAAATGAATGCTAAGGGT
Q46343_CLOSO/1-140 ------------ATGAATATAACAATATCTTTTTTATCAAAAAATATATTTATAAAACTAGTGATGCTAGCTATAACATTTGATACATTATTGGGATGTTTGAGGGCAATAAAAACCCAT------AAATTTAATTCTAGTTTTGGAATCAATGGAGGAATTAGAAAAATAGCAATGATAGCTTGTATATTTTTTCTATCAATAGTTGATATGCTAACACAATTCAATTTTTTATTTATATTGCCACAAGAATATATTAATTTTTTTAGATTTCAACATCTAGGAATATCAGAATTTTTTTCTATGCTATTTATTTTTTATGAAAGTATAAGTATATTAAAAAATATGTATCTATGTGGTTTACCAGTACCTAAAAATATACAAAACAAAATGTATAATTTGTTATATACAATAACAGACGAAGTAAAAATTGAGGAT