EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04924 alignment
(5 sequences with 1116 bp)


VA06_VARV/1-370 ATGGACAAACTTAGAGTTCTATACGATGAGTTCGTCACCATTAGTAAAGATAATCTTGAACGCGAGACTGGTCTTAGCGCATCAGATGTTGATATGGATTTTGATTTAAACATTTTTATGACGTTGGTTCCAGTCTTGGAGAAAAAGGTATGTGTT---ATCACACCAACTATAGAAGATGATAAAATTGTAACTATGATGAAATATTGTAGTTATCAGAGTTTTTCATTCTGGTTTCTTAAATCTGGCGCCGTTGTAAAATCGGTATATAATAAACTAGAT---GATGCGGAAAAGGAAAAGTTTGTAGCCACATTTAAAGACATGTTGCTTAATGTACAAACTCTAATTTCTCTTAACTCTATGTATACTAGACTGCGTCAAGATACCGAAGATATAGTATCCGATTCCAAAAAAATAATGGAGATTGTTTCCCATTTGAGAGCGTCGACTACAGAGAATGCGGCGTATCAAGTTCTCCAACAAAACAATAGTTTTATCATATCTACACTAAATAAAATCTTATCTGATGAAAACTATCTTTTGAAAATTATTGCAGTATTTGACTCTAAACTAATTTCTGAAAAGGAGACATTGAATGAATACAAACAATTGTACACCATTTCTTCTGAAAGTTTGGTATATGGAATCAGATGCGTTAGTAATCTGGATATATCATCTGTTCAACTGAGTAACAATAAATACGTTCTCTTTGTTAAGAAAATGCTACCTAAAATCATACTGTTTCAGAATAACGACATCAACGCACAACAATTTGCTAATGTTATTTCTAAAATTTATACTCTAATTTATAGACAATTAACGTCGAATGTCGATGTTGGGTGTCTATTAACAGACACAATAGAATCTACCAAAACTAAAATATCTGTAGAAAAATTTAAACAAACGGGTATTAATAATGTTCAAAGTCTTATTAAATTTATATCGGATAACAAGAAAGAATATAAGACAATAATCTCTGAAGAATATCTATCGAAGGAAGATAGAATCATTACTATTTTGCAAAATATCGTTAATGAACACGATATAAAGTACGACAATAACCTGCTAAATATGAGAGACTTGATTGTGACATTTAGAGAACGATATTCGTAT
Q9Q8Y3_9POXV/1-371 ATGGATAAGTTAAAAGTTTTATACGAGGACTTTTACCGTATCAGTAAACTATACTTGGAAAAGGAAACACAATCGACGACACTCGCTCCGGATTTTGATGTAGATGTATCCGTTTTTATGAATCTAGTACCCGTACTCGAACAAAAAGTGGTTCCC---GTAAACGCTGATATCGAGGACGATGACGTTCTACGTATGATGAAATATTGTAATTACAAATTGTTTTCATTTTGGTTTTTGAAGTCCAATGCGGTGGTTAAATCCGTCTACAACAAACTAGAAACAGATGATGAAAAACGTAATTTCACGAAACTGTTTAGGGGCATACTAACAAACGTTCAAACGCTTATTTCCATCAACAATATGTATAATAACATAAAACAGGATACTGTAGATATCGTCTCCGACTCAAAGAAAATAATCGACATCGTGAATCAAATAAAGAACGCAAATTGTGAAAGTAGTGCTTATAAACTGTTACAGACCAATTATAACTTTATCGTTAAAACGATTAATAAAATATTATCGGACGAAAACTATCTGCTCAAGATTATCGCGGTCTTTGATTCCAAGTTAGTAACGGACAAGGACAAACTTACCGAGTACAGGGAGATTTTTACCATCTCCACGGAAAGTATCATCTACGGAATACGGTGCATATCCGATCTAGATATACCCACCATCGAAGTCGAGAACAACAAATACGTCGCCTTCTTTAAGAAGATAATGGGGACGGTTATCCTGTTTCAAAACAACGACTTGAATCCGCAAAAGTTTATCCATGCTGTGTCAAAACTGTACGTATTAATCCATCAACAGTTTAAAACGAATCCAGAGGTCGCGTATCTGTTAACGGACGTTCTCGATTCGATAAAAACGAAAATATCAGTAGACGAAATAAAGCAGAAAGGCGTAAACAATCTACAATCCCTGATTAAGTTTATCTCGGACAATAAGACGTCGTACAAAGTTATTCTATCAGACGAATACACCAAACGGGAAGATTCCATCATCGACATTCTACAATCCATATCCGAGGAAAATCGTATAGAACACGGAGGTAAGGTCATCAATATAAGATATTTGATAGACATCACAAAAAATAGGTTCTTTTCG
Q9DHL6_YLDV/1-371 ATGGATAAGCTTAAAATTTTGTATAATGATTTTTACAAAACAAGCAAAAAATATTTGGAACAGGAAACTAATACAAAAACATTAGAAGCTAATTTTGAATTAGATGTTTCTATATTAATGAACTTAGTGCCTATATTGGAAAAAAAAGTAACGTTT---ATAACTTCTTCTATAACAGATGAAAATATAATCTTAATGATGAAATATTGCAATTACAAATTATTTTCATTTTGGTTTTTAAAATCTGGAGCTGTTGTTAAATCAGTATATAACAAGCTAGAATCAGATATAGAAAAAGAACAGTTTAAAAATATATTTAAGGAAATGTTACTAAATGTTCAGACGCTAATATCACTAAATAATATGTATACAAATTTAAAACAAGATACTGCAGAAATAGTATCTGATTCAAAAAAAATTATAGAAATAGTAAACCAAATTAAAAATTCAACATGTGAAAGCAGTGCTTATCATTTACTACAAAACAACTATAGTTTTATAGTAAAAACAATTAATAAAGTATTGTCTGACGAAAACTACCTGTTAAAGATGATAGCTGTTTTTGACTCTAATTTAATTAATGACAAGAACAAATTAAACGAATACAGAGAAATTTTTACAATATCTTCAAATAGCATTATTTATGGAATAAAATGTGTATCGGAACTTGAAATGCCAACGATAGATATAGACAACAATAAGTATGTATCTTTTTTTAAAAAAGTGCTATGTAACGTTATCTTATTTCAAAATAATGACTTAAATTCACACAGATTTATAAATGTTGTTTCTAAACTATACGTATTAATACAACAACAACTTATGACAAATCCTTTGGTAGCTTGTTTGTTAACTGATGTTTTGGATTCAATAAAAGCTAAAATATCTGTTGAAGAAATAAAACAAAAAGGAGTACGTAATTTTCAATCATTAATAAAATTTATATCGGAAAACAAGTCTTCTTATAAATTAATAATTTCTGCAGAATATATAAAACGAGAACAACAAATTATAGAAATATTACAAACGATATCTAATGAAAATAAAATAGAACATAATGGAAAAATTATAGATGTTAGTAATTTGATTAAAATAACAAAAAACAGGTTTTTTAAT
Q98276_MCV1/1-370 ATGGACCGGTTCCGTGCGCTCTACGGCGAGTTCTGCCGGCTCAGCGTGGAGCACCTGGAACGCGAGACGGGCACGCGCGCAGACGCGGTGGACGTGGACGTGGACGTGGATACCATGCTCTCGCTGCTGCCCATACTCGAACGCAAGGTGTGCGCG---CTGCACGCCGCC---AGCGACGAGCAGCTGCTTCTCTTCATGAAATACTTCAACTACAAGGTGCTGTCCTTCTGGTTCCTGCGCTCCGACGCGGTGGTGAAATCGCTGTACAACCGCCTGCAGGACGAGCCCGCGCGCGCGCATTTCCGCGAGCTCTTCCGCGCGCTCCTGGCGAGCACGCAGACGCTGGTTTCGCTGAACGCCATGTACCGCAACATCAAGCAGGACACGGCGGACATCATTGCCGACTCCAAGAAGATCCTGGAGATCGTGGCGCAGGTGCGTGCGACCACGTGCGAGCAGCAAGCCTACCGGCTGCTCAGTAGCAACTACAACTTCCTGGTGAAGACGGCCAACAAGGTCCTGTCGGACGAGAACTACCTGCTGAAACTGATCGCGCTCTTCAACACCGAGCTGGTGCAGGACCGCGAGCGCATGGAAGAGTACCGCGAGCTCTTCTCGCTGTCGGCCGAGAACGCCGTGCACGGCATCCGCTGCATGTGCGACGTCAGTGTGGAGGCCGTAGACTTCGCCGGCAGCCGCTACAGCGCGTTTTTCCGGCGCGTGCTCAGCAACGTGCTGCTCTTCCAGACGCACGGTCTGAACGCGCAGCGCTTCGTACAGATCGTGAGCAAGCTGTACACGCTGATCCACAGCGAGCTCACGCAGAACGCCGCGCTCGCCGAGATGCTCAGTGCCGTGCTCGACTCCATCAAGGACAGGCTCTCTGTGGACGAGCTGCGCCAGCACGGCGTGCGCAACCTGCAGTCGCTGGTACGCTACATTGCCAGCCGGCGCGAGTTCTACCGCGAGCTGCTGCTTGGAGAATGGCGCGCGCGCGAGGACACGCTAGTGCACTTGCTGCAGGAGATTGTCACGCGCAACGGCGTCCAGTTCCGCGAGAGCCCGGTTGACGTCGCCGCGGTGCTGCGCGCGCTGAAAGAACAGGTCTTCTCG
V170_FOWPV/1-372 ATGGAAAAGTTCAGGAATGCATTTATTGAATTTTATGAATTAAGTAAGAAGTATTTAGAGAATAGTACAGGTCAAAAAGTGTATGAAGTAAATTATGATAATGATATCGATTCATTTTTAACGGTTTTTCCTATTCTAGAAAGTAAGATAGGCGGTGATATTAACTGCGCAATGTCTGACGAGACTGTTATTCTAGCCATGCAGCAAGTAGAATTCAAGATGTTTACATTTTGGTATATGCGATCAGCGGCAAACGTAAAATCTATGCTCAACAAAATAACAGATAAAGAAACAAAAGAACAGTTTATCAGAATATTTAAAGATATGTTAGTATATGCAAAAGTTATTACATCTATAAACAATATGTACTCTAATATGAAAAAAGATACAAATGAAATAGTGCAGGATTTAAAAAAGATACTAGGAATTGTGTCGTTAATTAAAAGTGCTAATAACGAACATCAAGCTTACAAAATATTAATGGAAAACAATAGTTTCATTATCAGAACAATAAATAAAGTCCTAGCGGATAGCAATTATATCATAAAGATAATTGCACTTTTTAATACAGATGTAGTATCTGATAAGATAAAACTTGAAGAATATAAAGATGTATTTTCTTTCTCTAAAGAAAACGTAATATTTGGTATTAAGTGTTTCTGCGATATAACGATAGACGGTATAGACCAGATAAATAATAAATACGTAAGCTTCTTTAAAAAGGTATTACCTAATATTATTTTATTTCAAACTAGCTGTGTCAAAACAACACAATTTGTTAACATATTTTCTAAACTCTCTAGTATAGTGTATTCTGAAATACTTACTAACGAACGCTTACACGTTCTTTTTAGTGAAATAATGGCATCATTTAAGACTAAAGTTTCCGTAGAAGATTTAAAGAAAAGAAAGGTTAATAACATTCAGGGATTGATAAGTGAGATATCAAATAACCGTGAAATGTATAAAAACATATTTGTGGAAGAATATGAAAAGCACAAAACAACACTTATATCAATTGTTCAATGTATAACCGATAATTACAACATTAACTATAAAGAAAATGCTGTAGATATAGAATTCATATTCGATTTTATTCAAGAACATTATATATCT