EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF04596 alignment
(5 sequences with 411 bp)


V105_FOWPV/12-147 ATGAATCCATTTAGCGATATGGAAAATATAGTCATCAACGAAAAAGAAAAATGTATATTAGGAAACAGGTGTTTTGTCAAACTTTCAGAGGTATATAATATGCCTATGTGTTGTATAGATACCAATCAATGTTTAACTATGAATAGATTTAAATTTAGCTTAAATGAACTACTCTACACACCTTTTTACTATAAACAACTACAATATCAGTATCTAACACCCCAGTTCATATTTAGATGTATACAAGAAGCTAATGAAAACAATATGAGTTGCTATTACTGTTATACTAAGAAA---AAGGAACATAACGGATTAAATATTGATATTTTCATTCCAACTGCAAATTCAAAGTCTTATATAGTTATAGGACTACGTATAAAAGATTTTTGGAAACAATCTTTTAAAGTAAAT
O11314_MCV1/1-137 CTGCAGCCCTTCCACGACATGGACCGCGTCAAGATCAACCGCAAGGAAAACTGCATCCTGGGGAACCGCTGCTTCGTAAAGCTGGCCGAGGTCTTCCACATGCCGCGCTGCTCCGTGCCCACGAGCGCCAGCCTGTGCGCCAACAACCACTCTTTCACGCTGCACGAGCTGCTGTACTCGCCGTTCCACTACAAGCAGCCGCAGTACCAGTACCTGCTGCCGAGCTTCGTCTTCACCTGCATTGAGCTCGCGCGCAAGAACAACCAGACGTGCTACTACTGTAAGGCGGACCGCGCGAACGAGGAGGGCAGCCTCAACCTGAACATCTTCGTGCCCACGCTGGCGCGCTCCATGTACGTCGTCATCGGCATCCGGATCAAGGACTACTGGGTCGAGGCCTTCGAGATCGTG
Q9DHT3_YLDV/12-148 TTAAATCCTTTTAAAAATATGAATAAAATAAAAATAAATTTAAACGATAATTGTGTTTTAGGAAACAGGTGTTTTGTAAAAGTAGATAAAGTAAGATTTATACCATACAATTCTGTTGAAACGTCAAAACCTGTAATGATAAGAGGGTGTACATTCACACTGCCAGAACTTTTATATTCTCCTTTTCACTTTCAACAACCTCAAATACAGTATCTTATGCCAAGTTTTGTTTTATATTGTATAGAAGAAGCTAATAAAAATAAAAGTACAAGTAAATATTGTATAATAGACAAAAATACGGAAACTGATGAACTTAAAATAAATATATTTGTTCCAACATTTTTAAAATCAGTATATGTAATAATTGGGTTACGAATAAAACATTTTTGGTCTTCAAAGTTTAAAATAGAA
VF15_VARV/26-161 ATGAAACCTTTTAAGAATATGAATAAAATAACAATTAATCAAAAGGATAATTGTATATTAGCAAATAGATGCTTTGTTAAAATAGATACTCCTAGATACATACCATTGACATCCATTAGTAGTTCTAATATCATCAGAATACGGAATCATGATTTTACATTATCTGAACTATTGTATTCACCGTTTCATTTTCAACAGCCTCAGTTTCAATATCTCCTTCCTGGGTTTGTATTAACGTGTATTGATAAAGTTTCGAAACAGCAAAAAGAATGTAAATATTGTATCTCTAATCGTGGAGAT---GATGATAGTTTAAGCATTAATCTATTTATTCCAACTATTAACAAGTCTATATATATTATTATCGGTTTACGGATGAAAAATTTTTGGAAGCCTAAATTCGAAATAGAA
Q83606_9POXV/12-148 CTGAATCCGTTCAAGCACATGAATCGAATAAAGATAAACAGGGAGGAAAAATGTTTACTAGGTAGCACTTCTTTTATTAAGATAGATAAGGTTAAACACATTCCCGGTAACGCCGTAAACGTTTCGAAATCTATACACGTGCGAGGACAGGACTTTACGTTATCAGAACTGTTGTATTCCCCGTTGTATTTTCAGCAGGCGCGTGGACAATGTATCATGCCTCATTTTGTATTAAAATGTATAGACGAGGCTAAAAAAAATAGGATGGTCTGTAAATATTGTACAGTAACTAAATCGAGCGACCCACAGGGTTTAAACGCAAACATTTTCATTCCGACAAAAACGGAATCGACATATATTATCATAGGCATACGTATAAAAAGTTATTGGTCCGTTACATTTCGAGTGGAG