EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03978 alignment
(4 sequences with 531 bp)


Q93R10_BORBU/1-158 ATGAAAAAGAAAAACATATTTAAATTATTTTTTGTATCAATG------TTATTTGTAATGGCTTGTAAAGCATATGTGGAA------------------------------------GAGAAGAAACAAATAGATTCATTAATGGAAGGCATTTCAAAGCTTCAAAACGATTCTTCTAAGGACACATTTAAAGATTATAAAGATAAAATAAATAAATTAAAAGAAGGCTTGAAGGATGTAGGGAATGCA---GAACTTGAAGAAAAACTATTAGCTTTAGAAAAGCTCTTTAAAGATAAATTGGCGGCCAAATTAGCAGCGTTAAAGGCAGCTAAAGATAAAATTAATGGTTATACAGATAAGGATACAAAT---------AAAAATAATATATGGGCAGAAGCAAAACTGGTTGGAGTAACTGTAAAGATCTTGGGA---AGCAGTTCTAGAGGCAATGGAACAAAAATGTCTACAGAAGCTGTAGAGCAGATAGAAAAAATAATAAAGTTTCTTGAAGAGGGTACTAAT
Q44831_BORBU/1-160 ATGAAAAATAAAAACATAGTTAAATTATTTTTTGCATCAATG------TTATTTATAATGGCTTGTAAAGCATATGTAGAA------------------------------------GAAAAGAAACAAATAGATTCATTGAGTACAGGCGTTTCAACTCTTAATAATAAGATTGATCATAAGAAATTTAATAATTATAAACAAGAAATAAATAAATTAAAAGAAAGTTTAAAGGATGTAGGTAATGCA---GAGCTTAAAGAAAAACTATTGGCTTTAGAAAGTCTCTTCCAAGATAAATTGGCAGCTAAATTAGCAGCTTTAAAAGCAGCTAAACAAAAAATTGAGGGGACTACAGATGCTGACAATAAT---ACTGCAAAAAACAAGATATGGGCAGAATCAAAGTTGGTTGGAGTAACTATAAAGTTCAGCGGA---AGCAATACTGCTGGCAAAGGGCAAGAAATGTCTAAAGAAGCTGTAGAACAGATAGATGAAATAATAAAATTTCTCGAAGAAGGTACTAAT
O06698_BORBU/1-160 ATGAGAAATAAAAACATATTTAAATTATTTTTTGCAGCAATG------TTATTTGTAATGGCTTGTAAAGCATATGTAGAA------------------------------------GAAAAGAAAGAAATAGATTCATTAATGGAGGATGTTTTAGCTCTTGTAAATGATTCTTCTGGAGGCAAATTTAAAGATTATAAAGACAAAATAAATGAATTAAAAGAAAATTTAAAAGATATAGGCAATGCG---GAGCTTAAAGAAAAACTATTAAATTTGCAAAATTCCTTTCAGGATAAATTAGCGGCCAAATTAGCAGCGTTAAAAGCAGCTAAAAATACCATTGAAAACATTACTGACAAGGATCAGGAT---ATTTCAAAAAGAAAAATATGGTCAGAAGCAAAATTAGTTGGAGTAACTGTACCACTTCTTGGA---AGCAATACTTCTGGTAATGGGGATAAAATGTCTAAAAACGCTGTAGAACAGATAGACAAAGTAATAAAGTTCCTCGAAGAGGGCACTAAT
O50973_BORBU/1-175 ATGCAAAAAATAAACATAGCTAAATTAATTTTTATATTAATATTTTCATTATTTGTAATATCTTGTGAACTATTTATAATAAAAAGGAGAGCAACAATTACAGAAACAACAACAATAGAAAAAAAAAGAATAAATTGGCTTATTATGAGTGTCTCAGGCCTTAATGATGAGGCCGATGAAGTTGCATTTAAACATTGTAGAGAAAAAATAAGCTTATTAAAAGAAGACTTAAAATATGCAACTAATGCTAAAGAATTCGAAGAAAAATTTTTAAATTTACAAAAACTTTTTCAAGAAAAACTAACATCCAAACTAAACGCCTTAAAAGCAGTAAGAGTAGATATCCAAAGATTTAATGCAAACGATAATGATGATTTAGAAAAGAACAAACTCAAAATACGCTCAATAGCTCTATCAGCCGGAGTAAATACCAGTCCTATTGCACTCCATGCTATTAACATAAAAGAACTATCTGAAGACGTAGTAGCACATATAGACAGTATAATAAAATATCTTGAAGAA------GAT