EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03892 alignment
(5 sequences with 459 bp)


Q9PPD6_CAMJE/5-157 AAATTGGTTTTATTAGGAAGTGCTGCAGTGGTATTTTTTGCCGCTTGTGCAATGAATAGTGGGGTAAGTTCAGAACAAATTGGACTTAGAAAAGCAAGTTTAGAAAATGAAAATAAAGTAAATTTAGTGGAGGCAAATTTCACAACTTTACAGCCTGGGGAATCTACTCGTTTTGAGCGTTCTTATGAAAATGCACCACCATTAATTCCGCATGCTATTGAAGATTTGTTACCTATAACTAAAGATAACAATATGTGCTTAAGCTGCCATGATAAGGCTATAGCAGCAGATGCTGGTGCAACTCCACTTCCTGCTAGTCATTATTATGATTTTAGACACAATAAAACCACAGGAGATATGATTAGCGATAGTCGTTTTAATTGCACTCAGTGTCATGTTCCACAAAGTGATGCAAAACCTTTAGTGGGAAATAGCTTTAAACCTGAATTTAAAAATGAA
Q9CKL5_PASMU/1-140 ATGAAAAAAACAATGCTA---ATTTTGACCGCACTTTTTGCCTTCACGGTCAATGCCAATGAAGTC---------AAAGTGGGC------AAAAGTTTACAAGATTCA------CCTGAAAATATCGCGCCAGCCTTCCACAATACACCAAAAGAAAGT---GGCTTGGCG---CCGTTAAACTATGTGAACCAACCACCAATGGTGCCACACGCGACGAAAAAC---TATCAGGTGACGAAAAATATCAACCAATGTTTAACTTGTCATAGCCCAGAAGCCTCACGTGTTACTGGTGCAACACGCATCAGTCCAACCCACTTTATGGATCGT------GATGGTAACATTGTCGGAGGCACCTCACCTCGCCGTTACTTCTGTTTACAATGCCATGTCTCTCAATCTGATGTTGAGCCGATTATTCAAAATGAATTTAAACCGATGGCTGGTTTTGGT
NAPB_HAEIN/8-149 GTATCTAAAATTTTAGCGGGATTATTTACCGCACTTTTTGCTGGCTCACTGATGGCATCTGATGCACCA------GCAGTGGGA------AAAGATTTAACTCAAGCG------GCAGAAAATATTCCACCCGCATTTCATAATGCACCGCGTCAAGGC---GAATTACCC---GCATTGAACTATGTAAATCAGCCTCCAATGGTTCCACATAGTGTGGCAAAC---TATCAAGTGACAAAAAATGTAAATCAATGTTTAAATTGCCACAGCCCAGAAAATTCTCGTTTGAGCGGTGCAACTCGAATCAGCCCAACTCACTTTATGGATCGT------GATGGAAAAGTAGGTTCAAGTTCATCGCCACGTCGTTATTTCTGTTTACAATGTCACGTTTCTCAAGCAAACGTAGATCCGATTGTTCCAAATGATTTCAAACCGATGAAAGGTTACGGA
Q9KLR3_VIBCH/24-171 CAACTCATTGCCTTACTTTCAGTGTTTACCGTACTGGCTGGCATTGCTCATGCTGAGCTGAACAATCCAGGC---GGTATCGGAGGTCTAGAATCACTGCGCGGAGCAACAGAAATTGAAGCGACTCGCGCCGCTGATCCAATGAAGAAATACCCACGC---GAACAAGCGCTAGAGAGTGATTTTGTGTATCAACCACCACTCATCCCGCACAACATTCGCAAC---TATGAAGTATCGTTGAACGCCAACAAGTGCCTTGCGTGCCACAGTTGGAAAAACGCCAAAGAAATGGGCGCCACCAAGATCAGTGTCACTCACTTTGTGAACCGC------GAAGATGCGGTACTGTCGGACGTCTCTCCACGCCGCTACTTCTGTTTGCAGTGTCACGTCCCTCAGGCGGATGCAAAACCGCTGGTTGAGAACGATTTCGAACGTGTTGATTCACTTCGT
Q9I4G4_PSEAE/8-152 CTGCTCCTCGTCCTGCTCGGCGCCCCCGCGGCCTTCGCCGCCGACCTCGGCTACCCGCTGGACGCGCCCGCC---CCCGACGGC------CGCCGCCCCGGCGGCACG------CTGGCCGAAAGCCGCCCCGCGCCGCCGCTGGCGGCCGAGGAAAACAAGGACCTGAAACGCGAGCGCAACTACCCCGAGCAGCCGCCGACCATTCCCCACAGCATCGTCGGC---TATCGCATCGACAAGGACAGCAACAAGTGCCTGTCCTGCCACAGCCGCGCCAACAGCGCGCGAACCCAGGCGGTGATGATCAGCATCACCCACTACATGGACCGC------GACGGCCAGCCGCTGGCCGCCGTCTCGCCGCGCCGCTACTTCTGCGTGCAGTGCCATGTGCCGCAACAGGACGTAAAGCCGCTGGTCGACAACCGCTTCGAGAACATCGACCAGATCCTC