EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03851 alignment
(6 sequences with 939 bp)


UVE1_SCHPO/250-527 TTGGGGTATGCTTGTTTGAATACTATTTTAAGGTCAATGAAGGAGAGGGTTTTTTGTTCACGCACCTGCCGAATTACAACCATTCAACGTGAT------------------------------------------------------------------------------------GGGCTCGAAAGTGTCAAGCAGCTAGGTACGCAAAATGTTTTAGATTTAATCAAATTGGTTGAGTGGAATCACAACTTTGGCATTCACTTCATGAGAGTGAGTTCTGATTTATTTCCTTTCGCAAGCCATGCA------AAGTATGGATATACCCTTGAA---TTTGCACAATCTCATCTCGAGGAGGTGGGCAAGCTGGCAAATAAATATAATCATCGATTGACTATGCATCCTGGTCAGTACACCCAGATAGCCTCTCCACGAGAAGTCGTAGTTGATTCGGCAATACGTGATTTGGCTTATCATGATGAAATTCTCAGTCGTATGAAGTTGAATGAACAATTAAATAAAGACGCTGTTTTAATTATTCACCTTGGTGGTACCTTTGAAGGAAAAAAAGAAACATTGGATAGGTTTCGTAAAAATTATCAACGCTTGTCTGATTCGGTTAAAGCTCGTTTAGTTTTAGAAAACGATGATGTTTCTTGGTCAGTTCAAGATTTATTACCTTTATGCCAAGAACTTAATATTCCTCTAGTTTTGGATTGGCATCATCACAACATAGTG------CCAGGAACGCTTCGTGAAGGAAGTTTAGATTTAATGCCA------TTAATCCCAACTATTCGAGAAACCTGGACAAGAAAGGGAATTACACAGAAGCAACATTACTCAGAATCGGCTGATCCAACGGCGATTTCTGGGATGAAACGACGTGCTCACTCTGATAGGGTGTTTGACTTTCCACCGTGTGAT
UVE1_NEUCR/208-517 CTAGGTTATGCATGTCTCAACACCTACTTGCGCAACGCAAAGCCGCCCATCTTCAGCTCTAGGACTTGCCGTATGGCATCCATTGTCGATCACAGACATCCGCTTCAGTTTGAGGATGAGCCGGAACATCACTTGAAGAATAAGCCCGACAAGTCGAAGGAACCGCAGGATGAACTGGGACACAAATTTGTCCAGGAGCTTGGGTTGGCCAACGCCCGCGACATTGTCAAGATGCTGTGCTGGAACGAAAAGTACGGCATCAGGTTCCTCCGACTCAGCTCCGAGATGTTTCCCTTTGCCAGTCATCCG------GTACATGGTTACAAACTGGCGCCTTTCGCATCCGAGGTGCTTGCTGAAGCAGGAAGGGTAGCAGCTGAGCTTGGTCATCGCTTAACTACGCACCCCGGACAGTTTACCCAACTCGGCTCTCCTCGTAAAGAAGTAGTCGAGTCCGCCATCCGAGATCTCGAATATCACGATGAACTTCTCTCCCTTCTCAAGCTCCCGGAGCAACAAAACCGCGACGCAGTCATGATTATTCACATGGGCGGCCAATTCGGCGACAAAGCCGCCACCCTCGAGCGCTTCAAGAGGAACTACGCCCGCCTCTCCCAGTCCTGCAAGAATCGCCTCGTCCTCGAGAACGACGACGTAGGCTGGACAGTCCACGACCTCCTCCCCGTCTGCGAAGAGCTCAACATTCCCATGGTCCTCGATTACCACCACCACAACATCTGCTTCGACCCGGCCCACCTTCGCGAAGGTACTCTCGACATCTCGGACCCCAAGCTCCAAGAGCGCATAGCCAACACGTGGAAGCGCAAGGGCATCAAGCAGAAAATGCACTACTCCGAACCCTGCGATGGC---GCTGTCACCCCTCGCGACCGACGCAAGCATCGCCCACGCGTGATGACCCTTCCTCCCTGCCCG
UVSE_DEIRA/11-276 CTCGGGCTGGTGTGCCTGACGGTGGGGCCGGAGGTGCGCTTCCGCACGGTCACGCTCAGCCGCTACCGTGCGCTCTCGCCTGCCGAGCGCGAA------------------------------------------------------------------------------------------GCCAAGCTGCTCGACCTGTATTCGAGCAACATCAAGACCTTGCGGGGGGCCGCCGACTACTGCGCGGCGCACGACATCCGGCTCTACCGACTGAGTTCGAGCCTTTTTCCCATGCTCGACCTCGCGGGCGACGACACCGGGGCCGCTGTGCTCACGCATCTAGCGCCGCAACTGCTGGAGGCCGGGCATGCGTTCACCGACGCGGGCGTGCGGCTGCTGATGCACCCCGAGCAATTCATCGTGCTCAATTCCGACCGGCCCGAGGTGCGCGAGTCGAGCGTGCGGGCCATGAGTGCCCACGCCCGCGTGATGGACGGGCTGGGGCTGGCGCGCACGCCC------TGGAATCTGCTGCTGCTCCACGGCGGC---------------AAGGGCGGGCGCGGCGCTGAGTTGGCGGCCCTGATTCCCGACCTGCCCGACCCAGTACGGCTGCGGCTGGGTCTGGAAAACGACGAGCGGGCATACAGCCCCGCCGAGCTGCTGCCCATCTGCGAGGCGACCGGCACGCCGCTGGTCTTCGACGCGCACCACCACGTCGTCCACGAC------------AAGCTTCCCGACCAGGAAGACCCCAGCGTGCGCGAGTGGGTGCTGCGCGCGCGGGCGACGTGGCAGCCCCCG---GAGTGGCAGGTTGTCCACCTCAGCAACGGCATCGAGGGG---------------CCGCAGGACCGCCGCCACTCGCACCTGATTGCCGATTTTCCGAGTGCCTAC
UVSE_BACHD/5-276 TTCGGCTATGTCGCCATGAGTATGGAACTTGCCAATGCCTCACCATCAAAAACGATGACAGCTACTCAGTTTGAAAAAATCGAAGATCACGAGGCAGGT---------------------------------------------------------------------------------TTGCGAAAACTCGAACGGATTGCCAAAACGAACTTGCACAATTGCCTTAGGTTGCTCAAACACAACCTTGCCTACCAGATTTCATTTTTCCGCCTTTCTTCAAAGCTTGTACCACTCGTGAATCACCCT---TTAACAGAAGGATGGAAGTACGAGTTAGCCATTGCGGAAGAGCTTCAAGCCGTAGGAGAATTTGCCTCTGAGCACCAGATGCGGATCGACTTTCACCCTGATCATTTTGTTGTGCTCAATAGTGAGGCAAAGGAGATCACAAGGCGATCGTTGCAAACCCTCCTATATCATTATAAGTTACTAAAAGGGATGGAGATCGACCCGAGA------------CATCGCTGCGTCCTACATGTGGGGGGAAAGAAAAAAGGGGTAGAGGCAGGACTGGAACAGTTTATCGAAAATACCGCTAGTATTCCAAAGTCGTTATTATCTATGATCATGCTAGAAAATGATGATAAAAGCTATACAATTGATGATGTGCTCTATCTAGGTGAAAAGCTCGCCATTCCTGTTGTTTTAGATATCCATCACCATGACGTTTTG---------------CATCGGAGCAAATCATTACAGGAGACATGGCAA------------CGAATCGTCGCCACATGGGAGGATAGTCCGCTCCCCGTAAAAATTCATCTATCGAGTCCATTATCAGGTGAGGATGATCCTAGGCACCATGATTACATCAATGCTGATCGATTCATCGCCTTTTTGCATGAAATT
UVSE_BACSU/5-275 TTCGGGTTCGTTTCAAATGCGATGAGCCTTTGGGATGCGTCTCCCGCTAAAACATTGACATTCGCGCGTTATTCAAAGCTTTCAAAGACTGAAAGA---------------------------------------------------------------------------AAA---------GAAGCGCTTCTGACTGTGACAAAAGCCAATTTGCGCAATACGATGAGAACCCTTCACTATATCATCGGCCACGGCATTCCTTTGTACCGTTTTTCCAGTTCGATTGTGCCGCTGGCTACGCATCCC------GACGTGATGTGGGATTTTGTAACACCGTTTCAAAAAGAGTTTCGGGAGATTGGAGAGCTTGTTAAAACCCATCAACTGCGAACAAGCTTTCATCCAAATCAATTCACTCTGTTTACGAGCCCGAAGGAATCCGTCACAAAAAATGCGGTAACAGATATGGCGTATCACTACCGCATGCTTGAGGCCATGGGCATTGCTGATCGC------------TCCGTTATCAACATTCATATTGGCGGCGCTTACGGAAATAAAGACACCGCCACTGCACAATTTCATCAAAATATAAAACAGCTGCCGCAGGAGATCAAAGAGCGGATGACACTTGAAAATGATGATAAAACATATACAACGGAAGAAACGCTTCAGGTCTGTGAGCAGGAGGATGTTCCGTTTGTCTTTGACTTTCATCATTTTTACGCCAATCCA------------GACGATCACGCCGACCTGAATGTAGCACTGCCC------------CGCATGATCAAAACGTGGGAGCGGATCGGCCTTCAGCCAAAGGTTCACTTGTCTTCCCCAAAATCGGAGCAAGCGATACGCAGCCACGCCGATTATGTTGACGCCAACTTTTTGCTGCCACTGTTGGAACGCTTT
UVSE_BACCR/5-274 TTTGGATATGTCTCACATGCAATGGCACTCTGGGACTGTTCTCCTGCCAAAACAATGACGTTTACAAGCTTTAAGAAACTCAGCAAGCAAGAGCGA---------------------------------------------------------------------------GAA---------GACAAACTGTACCATGTTATAAGGCAAAATTTAGAGCACACAATACGTATCCTTCATTACAATATAGCGCATGAAATCCCACTATATCGCCTATCGTCTTCCATCGTCCCACTTGCAACACATCCC------GAAGTCGAGTTTGACTATATTGGGGTATTCACACCACTTTGGCGTAAAATAGGGGCTTTAATTAAAGAACACAATTTACGAATAAGTTTTCATCCAAATCAATTTACGCTATTTACAAGCGACAAGCCACATATTACTACTAACGCTATTACGGATATGACTTATCATTATAAAATATTGGATGCTATAGGCATTGCAGATTCT------------TCTTACATTAATATTCATGTAGGTGGAGCCTATGGAAATAAAGAAAAGGCAATTGAGCGCTTCCATGAAAACATAAAAAAACTTCCTACACATATAAAAAAACAAATGACTCTTGAAAATGATGATAAAACCTATACAACCGCTGAAACTTTATCAATTTGCCAAAAAGAAAATATTCCATTTGTATTTGATTATCATCATCATATGGCCAAT---------------CTTTGCGAGGAACCACTAGAAGAGTTGCTTCCT------------GCAATTTTTGAAACTTGGTCACATACAAATATCTCTCCTAAAGTTCACATTTCCTCCCCGAGATCGGAAAAAGAATTTAGGGCTCATGCTGAATATATCGATTTAGAGTTTATTAAGCCTTTCTTACACATTGCA