EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03623 alignment
(3 sequences with 417 bp)


Q9U531_DROME/945-1083 AGTCGACCACCTAACCGCGCAGATGACGAAGTTTATTGCGCCACCACACTGGTGGTCAAATCAATAATGGCGCTGTCACAAGGTGTGGAGAAAGCGAATACCGAGGGTTACTTGGAATTGGTTAAGAACGTGGGCGTCAAGTTGAGAAACTTGCTAACATCGGTGGACAAAATATCTATAATATTTCCAGCACAGGCCCTCAAGGAAGTGCAAATGGCACATCAGGTACTTTCAAAAGACATGCTCGAATTGGTCTCCGCGATGCGTTTGGCTCAACAATATAGTGACACAACGCTGGATTGTGAATATCGCAAGAGTATGCTGTCTGCTGCCCACGTTTTGGCTATGGACGCCAAAAACCTGTTTGATGTCGTCGATTCGATACGTCAACGTTATCAGCATCTATTCCCGCCATCC
FAK1_CHICK/915-1053 ACGGCCAACCTGGACCGCTCCAATGACAAAGTCTATGAGAATGTAACCGGGCTGGTGAAAGCTGTCATAGAGATGTCCAGTAAAATACAGCCAGCTCCGCCAGAGGAGTACGTGCCCATGGTAAAGGAGGTTGGCTTGGCGCTGAGAACCTTGCTAGCAACAGTGGATGAGTCGCTGCCAGTGCTTCCTGCAAGCACCCACAGAGAGATTGAGATGGCCCAGAAACTGCTGAACTCTGACCTGGCTGAGCTCATTAACAAGATGAAGCTGGCCCAGCAGTACGTCATGACCAGCCTGCAGCAGGAGTACAAGAAGCAAATGCTGACGGCTGCTCACGCTCTGGCTGTGGATGCCAAGAACTTGCTGGATGTCATCGATCAAGCCAGACTGAAAATGATCAGCCAGTCCAGGCCCCAC
FAK2_HUMAN/870-1008 ACAGCTAACCTGGACCGGACCGATGACCTGGTGTACCTCAATGTCATGGAGCTGGTGCGGGCCGTGCTGGAGCTCAAGAATGAGCTCTGTCAGCTGCCCCCCGAGGGCTACGTGGTGGTGGTGAAGAATGTGGGGCTGACCCTGCGGAAGCTCATCGGGAGCGTGGATGATCTCCTGCCTTCCTTGCCGTCATCTTCACGGACAGAGATCGAGGGCACCCAGAAACTGCTCAACAAAGACCTGGCAGAGCTCATCAACAAGATGCGGCTGGCGCAGCAGAACGCCGTGACCTCCCTGAGTGAGGAGTGCAAGAGGCAGATGCTGACGGCTTCACACACCCTGGCTGTGGACGCCAAGAACCTGCTCGACGCTGTGGACCAGGCCAAGGTTCTGGCCAATCTGGCCCACCCACCTGCA