EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03615 alignment
(4 sequences with 318 bp)


GCM2_MOUSE/21-123 TGGGACATCAATGACCCACAGATGCCTCAGGAACCA---ACCCACTTTGACCACTTCCGGGAGTGGCCTGATGGCTACGTGCGCTTCATCTACAGCAGCCAGGAGAAGAAGGCTCAGCGCCACCTGAGTGGCTGGGCCATGCGCAACACCAACAACCACAATGGCCACATCCTCAAGAAGTCCTGCCTGGGCGTGGTGGTGTGCGCACGCGCTTGCGCCCTGAAGGATGGCTCGCACCTGCAGCTGAGGCCAGCCATCTGTGACAAGGCCCGGCTGAAGCAACAAAAGAAAGCTTGCCCCAAC------TGTCACTCG
GCM1_HUMAN/16-118 TGGGATATTAATGATGTGAAACTGCCACAGAACGTG---AAAAAAACCGACTGGTTCCAGGAGTGGCCAGATTCCTATGCCAAACACATCTACAGCTCGGAGGACAAGAATGCGCAGCGGCACCTGAGCAGCTGGGCCATGCGCAATACCAACAACCACAACTCCCGCATCCTCAAGAAGTCCTGCCTGGGTGTGGTGGTGTGCGGCCGCGACTGTCTCGCAGAGGAGGGGCGCAAGATCTACCTGAGACCTGCCATCTGTGACAAGGCCCGGCAGAAGCAGCAGCGGAAACGCTGTCCCAAC------TGTGACGGG
GCM_DROME/34-137 TGGGACATCAACGATTCCAAGATGCCGTCGGTGGGG------GAGTTTGACGATTTCAATGACTGGTCCAACGGACATTGCCGGCTCATCTACTCCGTGCAGAGTGATGAGGCCAGGAAACATGCCAGCGGTTGGGCCATGCGAAACACCAACAACCACAACGTGAATATCCTAAAGAAGAGCTGCCTGGGAGTGCTCCTCTGCAGTGCCAAGTGCAAGTTGCCCAATGGAGCCAGTGTGCATCTGAGACCCGCCATTTGCGACAAGGCCAGAAGGAAGCAGCAGGGCAAACAGTGTCCCAATAGAAATTGCAATGGT
GCM2_DROME/74-179 TGGGACATCAATGATGCCATTGTGCCACATGTGCCGGACCAGGAGTTCGACGAGTTCAACGAGTGGAGCGACGGGCATGTGAGGCACATCTATTCGCTGCACAACGAGGAGGCCAAGAAGCACATTTCCGGCTGGGCCATGCGCAACACGAACAACCACAACGTGAACATTCTGAAGAAGAGCTGCCTGGGCGTCCTGGTCTGCTCCCAACACTGCACCCTGCCCAACGGATCCAAGATCAACCTGCGCCCAGCCATTTGCGACAAAGCCCGGCGGAAGCAGGAGGGCAAGGCGTGTCCCAACAAAAGTTGTCGTGGC