EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02667 alignment
(4 sequences with 1434 bp)


Q9ZLE5_HELPJ/3-453 TTATTAAGGCATTTGACTTCAGCGTGCGTGTTTTTAGCGTCTAAATGTTTGCCGGACTCCTTTGTCTTGGTCGCTCTTTTATCGTTTGTCGTGTTCGTTCTTGTTTATTGTTTGACAGGGCAAGACGCTTCGTCT---------------------------GTCATTTCTAGTTGGGGGAATGGTGCTTGGACGCTTTTAGGTTTTTCTATGCAAATGGCTCTTATTTTGGTATTGGGTCAGGCTCTAGCTAGCGCTAAATTAGTCCAAAAACTTTTAAAATACTTGGCGTCTTTGCCTAAGGGGTATTACACCGCTTTATGGTTGGTTACTTTTTTATCGTTAATCGCTAATTGGATCAACTGGGGTTTTGGCTTGGTGATTAGCGCGATTTTTGCAAAA------------GAGATCGCCAAAAATGTTAAGGGGGTGGATTATAGGTTGCTCATTGCTAGCGCTTATTCGGGTTTT---GTGATCTGGCATGGGGGTTTATCAGGCTCTATCCCTTTAAGCGTTGCCACCCAAAATGAAAATCTATCCAAAATAAGCGCTGGG------GTGATTGAAAAAGCTATCCCTATCAGTCAGACGATTTTTTCTTCTTATAATTTGATCATTATAGGGATCATTCTTATAGGGTTACCCTTTTTAATGGCAATGATCCACCCTAAAAAAGAAGAAATCGTTGAAATTGATTCA------------------AAGCTTTTAAAAGACGAATACAAAGAAACAGAACTCATTAGCCACCAACAAGATAAAACGATCGCGCATTTTTTGGAAAACAGCGCTTTGCTTTCTTATCTTTTGGTTTTTTTGGGTTTTGGGTATCTTGGTATTTATTTTTTTAAAGGGGGAGGG---------ATTAGTTTAAACATTGTCAATACGATTTTCCTTTTTTTAGGGATTTTGCTCCATAAAACCCCTTTAGCTTATGTGAAAGCGATCAATCATTCCGCTAGGAGCGTGGCTGGGATTTTACTCCAATTCCCTTTTTACGCTGGGATTATGGGGATGATGGCAAGCCATAGC------GTGGGGGGGCATTCTTTAGCGCAAATGCTCTCTTTAGCCTTCACGCACATCGCTAATGAAAAAACTTTCGCGCTCATGACTTTTTTGAGCGCGGGGATTGTCAATATTTTTATTCCATCAGGCGGAGGGCAATGGGCGATTCAAGCTCCTATCATGCTCCCTGCTGGGCAAAGCTTGGGGGTGGATCCGGGCGTGATTTCTATGGCTATCGCTTGGGGAGACGCTTGGACGAACATGATACAGCCTTTTTGGGCTTTGCCCGCATTAGCCATTGCGGGTTTGGGCGCTAAGGATATTATGGGCTATTGCGTTTTGACTTTAATTTTTGTAGGCTTAGTGGTGTGCGGGGTGTTTTATTTTTTG
ATOE_HAEIN/1-447 ATGATTAGTCGCGTTTCTCGTTTTATGACGACATTCGTCAGTAAATACCTGCCAGACCCACTTATTTTTGCCGTGTTACTCACCTTTGTCACATTCATTTGTGCTTGGGGATTAACCGATAGTACACCTGTTGAT---------------------------TTAGTTAATATGTGGGGTAATGGCTTTTGGAATTTACTTGGTTTTGGTATGCAAATGGCATTAATTGTCGTAACTGGTAATGCTCTTGCAACCTCACCACAAATTCGTAAGTTTCTTTCTACAATCGCTTCAATCGCAAAAACACCAGCACAAGGTGTTGTCTTAGTTACGTTTATGGGTTCAATTGCCTGTATCATTAACTGGGGCTTCGGTTTGGTCGTTGGTGCGATGTTTGCAAAA------------GAAGTCGCGCGGAGAATAAAAGGCAGTGACTACGCCTTACTGATTGCCTGTGCCTATATTGCATTT---ATGACATGGGGTGGAGGTTTTTCAGGCTCAATGCCACTTTTAGCCGCAACACCAGGCAACCCAGTTGCTCATTTAATGATGAGCGAAAGCAACCCACAAGGTATTATTCCTGCAGTTAGTACGCTTTTCTCTGGGTACAATATTTTTATCACGTTAAGTTTAGTCATTTGCTTGCCTTTCATTACCTATATGATGATGCCCAAAAATGGCGAAACAAAAAGTATTGATCCA------------------AAACTTATTGCGCCCGATCCAACATTTGATAAAAAATTGGAT------AAAGATGCAACACTTGCTGAAAAAATGGAAGAAAGCCGCTTCTTAGCCTATACAATCGGGGCATTAGGATATAGTTACCTCGGTATGTATTTCTACAAAAACGGATTCAAT------CTCACAATTAATAATGTAAACCTTATTTTCTTAATCACAGGAATTGTGCTTCATGGCTCGCCAATGGCCTATATGCGAGCAATTATTAATGCCACACGAAGCACAGCAGGGATCTTAGTGCAATTCCCATTCTATGCGGGTGTGCAACTAATGATGGAGCATTCAGGC------TTAGGTGGT---------------TTAATCACCGAATTCTTTATCAATGTTGCTAACAAAGATTCTTTCCCATTATTAACCTTCTTTAGTTCTGCCTTTATTAACTTTGCAGTTCCTTCTGGTGGCGGTCACTGGGTCATCCAAGGACCATTTGTTATCCCTGCTGCTCAAGCATTAGGTGCAGATCTAGGTAAGTCTACAATGGCGATTGCCTATGGTGAGCAATGGATGAACATGGCTCAGCCATTTTGGGCATTACCAGCACTGGGTATCGCAGGGCTTGGCGTGAGAGATATTATGGGCTTCTGTATGACCGCACTTATCTTCACCGCACCAATTTTTATTATTGGTTTATATTTCTTA
ATOE_ECOLI/1-440 ATGATTGGTCGCATATCGCGTTTTATGACGCGTTTTGTCAGCCGGTGGCTTCCCGATCCACTGATCTTTGCCATGTTGCTGACATTGCTAACATTCGTGATCGCGCTTTGGTTAACACCACAAACGCCGATCAGC---------------------------ATGGTGAAAATGTGGGGTGACGGTTTCTGGAACTTGCTGGCGTTTGGTATGCAGATGGCGCTTATCATCGTTACCGGTCATGCCCTTGCCAGCTCTGCTCCGGTGAAAAGTTTGCTGCGTACTGCCGCCTCCGCCGCAAAGACGCCCGTACAGGGCGTCATGCTGGTCACTTTCTTCGGTTCAGTCGCTTGTGTCATCAACTGGGGATTTGGTTTGGTTGTCGGCGCAATGTTTGCCCGT------------GAAGTCGCCCGGCGAGTCCCCGGTTCTGATTATCCGTTGCTCATTGCCTGCGCCTACATTGGTTTT---CTCACCTGGGGTGGCGGCTTCTCTGGATCAATGCCTCTGTTGGCTGCAACACCGGGCAACCCGGTTGAGCATATCGCCGGG---------------------CTGATCCCGGTGGGCGATACTCTGTTCAGTGGTTTTAACATTTTCATCACTGTGGCGTTGATTGTGGTGATGCCATTTATCACCCGCATGATGATGCCAAAACCGTCTGACGTGGTGAGTATCGATCCA------------------AAACTACTCATGGAAGAGGCTGATTTTCAAAAGCAGCTACCG------AAAGATGCCCCACCATCCGAGCGACTGGAAGAAAGCCGCATTCTGACGTTGATCATCGGCGCACTCGGTATCGCTTACCTTGCGATGTACTTCAGCGAACATGGCTTCAAC------ATCACCATCAATACCGTCAACCTGATGTTTATGATTGCGGGTCTGCTGCTACATAAAACGCCAATGGCTTATATGCGTGCTATCAGCGCGGCAGCACGCAGTACTGCCGGTATTCTGGTGCAATTCCCCTTCTACGCTGGGATCCAACTGATGATGGAGCATTCCGGT------CTGGGCGGA---------------CTCATTACCGAATTCTTCATCAATGTTGCGAACAAAGACACCTTCCCGGTAATGACCTTTTTTAGTTCTGCACTGATTAACTTCGCCGTTCCGTCTGGCGGCGGTCACTGGGTTATTCAGGGACCTTTCGTGATACCCGCAGCCCAGGCGCTGGGCGCTGATCTCGGTAAATCGGTAATGGCGATCGCCTACGGCGAGCAATGGATGAACATGGCACAACCATTCTGGGCGCTGCCAGCACTGGCAATCGCCGGACTCGGTGTCCGCGACATCATGGGCTACTGCATCACTGCCCTGCTCTTCTCCGGTGTCATTTTCGTCATTGGTTTAACGCTGTTC
O28734_ARCFU/8-484 GCCCTGGAGAGAATGGGAGCAAGACTGTGCGCAAGCGTGGAGAAATGGATGCCGGACCCATTAATCTTTGCTCTGCTTCTGACTTTGGTGACTTATCTGTTGGTAATAGTGGTGATGAAGCCGTACACAGTGATGGATGCGGGAACGATGGTTAAGTGGCTCCTCGTGGATGTTTGGTACAAAGGCTTCTGGGGTCTCCTGTCCTTCGCCATGCAAATGTGTTTGATTCTTGTTACCGGTTATGCAATAGCCTATCATCCAATCGTTTACAGGATTTTGAAAAAGATAGCGACACTCCCTTCAGATACTAAATCGGCTGCAGCTCTTACGGCACTTATTGCAATGATTGCAGCTTGGATAAACTGGGGACTTGGACTTATAGTTGGGGCCATTTTGGCCAGAACAATTGGAATTGAATTCTACAGAACAGGAAAGCCATTGCACTATCCGGCTGTAGTAGCAGCCGGTTATGCCGGTTTAGGACTTACTTGGCATTGGGGTTTATCGGCTTCTGCACCATTATTGATTAACACGCCAAATCACTTTCTAAAGGATGTTTTCGTGGAGTTGTTCGGC---AGGGAGACAGTTCCGCTGAACGAGACCATCTTTCATCCATATACTCTTATAAATCTGGCAATAATCATTTCTTTCGGGGTACTGGCTTATTACGCGCTTGCGCCTAACAGGGGTGAATTGAAAGGAATAGACAAAGTTGCACCACACATAATTGAGCTGGTGAAGAAAGAAAAGGAAGAGGAGCTGAAAGAAAAAAGTAAAGAGCGCGTAACGATTGCTGACAAGCTTGAGAACAGTAAAGTTCTCGCCCTACTAATAAGCATATTGGGGATTATCACGATGGGCTACTGGTTCTACGAGAAAGGCTTTTTCGGTGGACTAAACCTAAATTCGCTGAATTTTACGTTTATAATGGTTGGCCTTCTTCTCTACATGAATCCCATAGCTTACATGAGGGCTATCACCAGAGCGGCAGGAGCAGTAGCAGGAATACTGGTTCAGTTTCCGTTCTATGCGGGTATTATGGGAATGATGAGGTACAGTGCAGTTGTTGCAGGGGGACCAAATCTTGCAACTGTTATAGCCAACAGTATAGCGAGCGTTGCAACGCCGTTTACGTGGCCGGCAATATGTTTATACATTGCAGGGCTGATAAACATATTCATACCTTCTGGAGGTGGAGAATGGGCAGCAGTTGGAGAGATTTTAGCAAGAACGTCAGCTGCCCTGGGTGTGCCTATTGGAAAAACCGTAATTGCTTATGGTGTAGGGGACGCTTGGACAAACCTCTTCCAGCCATTCTGGGCGATTCCTCTCCTCGGACTTACGGGAACAAGGGCCAGAGATGTTTTTGGATACACGATCTCCGTGATGATATTGGCAACCATTCCGCTCTCGCTCGGTTTAGTTCTCGTT