EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02388 alignment
(11 sequences with 1329 bp)


Q9ZNI0_STAAU/6-413 TTAAGTGAAGAAGAATTTACCAACTACACCAAAAAGCAC------TTCAAACATTATACGCAGTCTATAGAATTATATAATTATAGAAATAAAATAAATCATGAAGCACATATTGTGGGAGTGAAGAATGATAAAAATGAAGTTATAGCTGCATGTTTATTAACAGAGGCACGAATTTTTAAATTCTACAAATATTTCTACTCTCATAGAGGTCCTTTACTTGATTATTTCGATGCTAAATTAGTTTGTTACTTTTTTAAAGAATTATCTAAATTCATTTATAAAAATAGAGGAGTATTT---ATTCTTGTTGATCCATATTTAATAGAGAATTTAAGAGATGCAAATGGTAGGATAATAAAGAATTATAAT---AATTCAGTGATAGTAAAGATGCTAGGGAAAATTGGG------------------TATCTCCATCAAGGTTATACAACAGGATATTCAAAT------------------------------AAAAGTCAAATTAGGTGGATTTCTGTATTGGATTTAAAAGATAAAGATGAGAATCAACTTTTAAAAGAAATGGAATACCAAACTAGAAGA------------AATATAAAAAAGACTATTGAGATTGGTGTTAAGGTTGAAGATTTATCTATTGAAGAAACAAATCGATTTTATAAATTGTTTCAAATGGCTGAAGAAAAACATGGTTTTCATTTCATGAATGAAGATTATTTTAAACGAATGCAAGAAATATATAAAGATAAGGCAATGTTAAAGATAGCTTGTATAAATCTTAATGAATATCAAGATAAATTAAAAATACAATTATTGAAAATCGAAAATGAAATGATGACTGTGAACAGAGCATTAAATGAAAATCCAAATTCTAAAAAAAATAAATCAAAATTAAATCAGTTAAATATGCAATTATCTAGTATTAATAATAGAATTAGTAAAACCGAAGAACTAATATTTGAAGATGGACCT---------------------------------GTTTTGGATTTAGCTGCTGCTTTATTTATATGTACTGATGATGAAGTTTATTATCTATCAAGTGGATCAAATCCGAAATATAATCAGTATATGGGTGCATATCATCTACAATGGCATATGATAAAATATGCAAAATCACATAATATTAATAGGTATAATTTTTATGGAATAACAGGCGTCTTTAGTAATGAGGCGGATGATTTTGGTGTTCAACAATTTAAAAAGGGTTTTAATGCACATGTTGAAGAATTAATTGGTGATTTCATCAAACCAGTAAGACCAATTCTATATAAATTTGCAAAACTTATTTATAAG
O33609_STACP/6-413 TTATCCAAAACTGAATTTCAAAATTTTGTAAACAGTCAT------TTTTCTCACTATACTCAATCAAATCAACATTTCGATTATCGAAATAAATTTCAAAATGACGTTCATTTAGTTGGCGTTAAAGATAATGTAGGAACAGTCATTGCAGCATGTTTATTAACAGAAGCCCAAGCTCTAAAAGTTTTTAAATACTTTTATACTCATCGTGGCCCTGTTTTAGACTTTAAAAACTTTGAATTAGTGAGATTTTTTTATAAAAATTTAACTAGATATCTTAAAAAAAATCGTGGTTTATTT---GTTTTAACAGATCCTTATACTTTAGAAAATATAAGAAATGCACAAGGTGAGATATTAACAAGCTATGAT---AATAGACCTCTGATTAAAACTTTGAAAAATATAGGG------------------TATAAACATCAAGGTTATTCCATAGGTTATTCTCAA------------------------------ACGAGTCAAATCAGATGGCTGTCTGTCTTAGATTTAAATAATAAAAATACAGATATGCTTTTATCCGAAATGGATTATCAAACAAGAAGA------------AATATTAAAAAAACATATGAAATGAATGTTCAAGTGAGAACTTTATCTATTGAAGAAACATCTAGATTTTTCAAATTATTTAAAATGGCAGAAGAAAAACATGGATTTAAATTTAGAAATCAAGATTATTTTGAAAAAATGCAAAAAATATATAATGACAATAGTATGTTAAAACTCGCATATATCAATTTATCCGATTTATTAGAAAAACAAAATAATAAAATAACTCAATTAAACAAACAATACGAAGAAATAATAAACGCATTAAAAGCAAATCCTAATTCGAAAAAAAATAAAAATAAGGCTAATCAAATTAATCAACAAATTAGTGCACAAAACAGAAAAATAAATGAAACAAAAGAATTAATCAAAACAGATGGCAAA---------------------------------ATAATTGATTTAGCTGCAGCTTTCTATATATATAACAATGACGAAGTTTATTATCTTTCAAGTGGATCAAATCCCAAATACAATGCTTATATGGGAGCCTATCGTTTACAGTGGGAAATGATTAAATTTGCTAAACAGAATAACATTCCTAGATATAATTTTTATGGTATTACTGGAGATTTTAGTGAAACAGCCGAAGATTATGGTGTTCAAAGATTTAAAGAAGGATTTAATGCTTATGTTGAAGAATATATAGGAGATTTTATTAAACCTCTTAGACCCTTTATTTACAAAATATACACTCTACTAAAAAGA
O05989_STASI/6-413 CTAAACATTCAAGAGTTCGAAGAATTTGTGTTTCAAAAA------ATGTCTCATTACACACAATCTGCTTCTCATTTTGAATATAGAAATAACCATCAGAATAATGTGCATTTAGTTGGCGTAAAAAATGAAACAGGTGAAGTATTAGCTGCTTGTTTACTGACTGAGGCACGTTGTTTAAAGTTCTTTAAATATTTCTATACACATCGCGGTCCAGTCATGAACTTTAAAGACCATGAGTTAGTCAGATTTTTTTATGAAAACTTAACGACCTATCTAAAAAAGCAAAACTGCTTATAT---GTTTTAACTGACCCTTACCTGTTAGAAAATATTCGAAGTTGTGACGGAGAAATCCTTGAATCTTATGAT---AACGAAACTTTTATGAACGTGATGAATTTATTAGGT------------------TACCGTCATCAAGGGTTTACTACAGGTTATTCTCAA------------------------------ACAAGTCAGATCAGATGGTTGTCGGTCTTAAACCTAGAAAATAAAGATGAAAAACAATTGTTAAAAGAAATGGATTATCAAACACGCCGT------------AATATTAAGAAAACCTATGAAATGCAGGTGAAAGTCCGCGATTTATCAATTAATGAAACAGATCGATTTTTTAAATTATTTAAAATGGCTGAAGAAAAACATGGCTTCAAATTCAGAGAACAAAGTTATTTTGAAAGAATGCAGAAAACATACGCTGATAATAGTATGTTAAAGCTGGCTTACATCGATTTAGAAGAATTATTAGAGACACAAAATGCGAAAGTCGCTGAGTTAAATACAGATATTGAAAATATTCAAGCGGCATTAAAAGAAAACCCTAATTCTAAGAAAAACAAAAATAAATATGCGCAATACCAAAAGCAATTAGCAGCACAAGAACGAAAAATTACTGAAACGAAAAAATTGATAGAAACAGATGGACCT---------------------------------GTATTAGACTTAGCTGCAGCTTACTATATCTATACCCCTCATGAAGTTTACTACCTATCCAGTGGTTCAAACCCTAAATACAATGCCTATATGGGTGCGTACAGACTCCAATGGGAAATGATTCAATTTGCGAAAAATAAAGGTATTAATCGCTATAATTTTTACGGTATTACAGGAGATTTCAGTGAAGATGCTGAAGATTTCGGTGTTCAAAAATTCAAAGAAGGCTTTAATGCCCATGTTGAAGAATATGTCGGCGACTTCATTAAACCGATTAAACCTTTATTTTATAAAATTCATCAATTATTAAATAGA
Q9ZFG7_STAHA/6-414 TTAACAGCTACAGAGTTTGGCAATTATACAGATAAGATGCCA---TATAGTCATTTCACACAAATGACTGAAAACTATGAGATGAAAGTTGCAAATAAAACAGAAACTCACTTAGTTGGTATAAAAAATAAAGATAATGAGGTTATTGCAGCCTGCATGTTGACAGCAGTACCAGTCATGAAATTTTTTAAGTACTTTTATTCTAACCGAGGACCTGTAATTGATTATGATAATAGAGAGCTTGTTCACTTTTTCTTTAATGAGTTAACAAAGTATTTAAAACAGCATAATTGTCTATAT---GTTCGAGTTGACCCTTATTTACCATATCAATATTTAAATCATGATGGTGAAATTACAGGTAATGCTGGT---AATGATTGGTTCTTTGATAAGATGAAGCATCTCGGA------------------TTTGAACATGAAGGCTTTACTAAAGGTTTTGATCCG------------------------------ATTAAACAAATCCGATATCATTCTGTTTTAGATTTAAAAAATAAAACATCTAAAGATATATTAAATGGAATGGATAGTCTACGTAAACGT------------AATACTAAAAAAGTTCAAAAAAATGGTGTGAAAGTTAAGTTCTTATCAGAAGAAGAACTTCCAATCTTCCGTTCATTTATGGAAGATACAACCGAAACGAAAGAATTCCAAGATAGAGATGATAGTTTCTATTATAATCGCTATAGACATTTCAAAGATCACGTGCTTGTACCACTAGCTTATATTAAGTTTGATGAGTACATCGAAGAATTACAAAATGAACGTGAAACTTTAAATAAAGATGTTAATAAAGCTTTAAAAGATATTGAAAAACGACCAGACAATAAAAAGGCATTTAATAAAAAAGAAAATCTTGAAAAACAATTAGATGCCAATCAACAAAAATTAGACGAGGCTAAAAAATTACAAGCCGAACATGGTAAT---------------------------------GAATTACCAATTTCAGCAGGTTTCTTCTTTATTAATCCATTTGAAGTTGTTTATTATGCAGGTGGAACTTCTAATAAATATAGACATTTTGCAGGCAGTTATGCTATTCAATGGACAATGATTAACTATGCAATTGATCATGGTATTGATAGATACAATTTCTATGGTATTAGCGGTAATTTTAGTGAAGACGCTGAAGATGTTGGAGTCATTAAATTTAAAAAAGGTTTCAATGCAGACGTAATTGAGTATGTTGGAGACTTTGTGAAACCTATTAACAAACCTTTGTATTCAGTGTATAAGACACTCAAAAAG
FEMA_STAAW/19-427 TTAACAGCTAAAGAGTTTGGTGCCTTTACAGATAGCATGCCA---TACAGTCATTTCACGCAAACTGTTGGCCACTATGAGTTAAAGCTTGCTGAAGGTTATGAAACACATTTAGTGGGAATAAAAAACAATAATAACGAGGTCATTGCAGCTTGCTTACTTACTGCTGTACCTGTTATGAAAGTGTTCAAGTATTTTTATTCAAATCGCGGTCCAGTGATTGATTATGAAAATCAAGAACTCGTACACTTTTTCTTTAATGAATTATCAAAATATGTTAAAAAACATCGTTGTCTATAC---CTACATATCGATCCATATTTACCATATCAATACTTGAATCATGATGGCGAGATTACAGGTAATGCTGGT---AATGATTGGTTCTTTGATAAAATGAGTAACTTAGGA------------------TTTGAACATACTGGATTCCATAAAGGATTTGATCCT------------------------------GTGCTACAAATTCGTTATCACTCAGTGTTAGATTTAAAAGATAAAACAGCAGATGACATCATTAAAAATATGGATGGACTTAGAAAAAGA------------AACACGAAAAAAGTTAAAAAGAATGGTGTTAAAGTAAGATTTTTATCTGAAGAAGAACTACCAATTTTTAGATCATTTATGGAAGATACGTCAGAATCAAAAGCTTTTGCTGATCGTGATGACAAATTTTACTACAATCGCTTAAAATATTACAAAGACCGTGTGTTAGTACCTTTAGCGTATATCAACTTTGATGAATATATTAAAGAACTAAACGAAGAGCGTGATATTTTAAATAAAGATTTAAATAAAGCGTTAAAGGATATTGAAAAACGTCCTGAAAATAAAAAAGCACATAACAAGCGAGATAACTTACAACAACAACTTGATGCAAATGAGCAAAAGATTGAAGAAGGTAAACGTCTACAAGAAGAACATGGTAAT---------------------------------GAATTACCTATCTCTGCTGGTTTCTTCTTTATCAATCCATTTGAAGTTGTTTATTATGCTGGTGGTACATCAAATGCATTCCGTCATTTTGCCGGAAGTTATGCAGTGCAATGGGAAATGATTAATTATGCATTAAATCATGGCATTGACCGTTATAATTTCTATGGTGTTAGTGGTAAATTTACAGAAGATGCTGAAGATGCTGGTGTAGTTAAATTCAAAAAAGGTTACAATGCTGAAATTATTGAATATGTTGGTGACTTTATTAAACCAATTAATAAACCTGTTTACGCAGCATATACCGCACTTAAAAAA
Q9ZFG2_9STAP/6-414 TTAACGACGGCTGAATTTGGTGCGTTTACAGATCAAATGCCA---TATAGCCATTTCACGCAAATGGTAGGGAACTATGAATTAAAGGTTGCTGAAGGTGTTGAAACACATCTTGTCGGCATTAAAGATAACAACAATAACGTACTAGCAGCATGTTTACTGACAGCAGTGCCAGTAATGAAGTTTTTTAAATATTTTTATTCAAACCGCGGACCAGTCATGGACTACGAAAATAAAGAGCTCGTTCATTTCTTTTTTAATGAACTTTCAAAATATGTTAAGAAATATCACGCATTGTAT---TTGAGAGTAGACCCTTATTTACCAATGTTAAAGCGAAACCATGATGGTGAAGTGATTGAAAGATACGGC---AGTGACTGGTTTTTTGATAAAATGGCTGAATTAAAC------------------TTTGAACATGAAGGTTTCACAACTGGGTTTGATACA------------------------------ATAAGGCAAATTCGTTTTCATTCTGTGCTCGATGTTGAAAATAAAACATCAAAAGACATCTTAAATCAAATGGATAATTTAAGGAAAAGA------------AATACGAAAAAAGTACAGAAAAATGGTGTGAAAGTCCGCTATCTAAACGAAGATGAATTACATATTTTCCGTTCGTTTATGGAAGATACATCTGAAACAAAAGATTTTGTAGATAGAGATGACGATTTTTATTATCATCGTATGAAATACTATAAAGATCGTGTCCGCGTACCACTAGCGTATATTGATTTTAATGCATATTTAGCAGAGCTCAACACTGAAGCGCAAGACTTTAAAAAAGAAATTGCAAAAGCAGATAAAGACATCGACAAGCGTCCTGAAAATCAGAAAGCCATAAATAAAAAGAAAAATTTAGAGCAACAACTAGAAGCGAATCAAGCTAAAATAAAAGAAGCAGAAACATTGCAACTTAAACACGGTGAC---------------------------------ACATTACCGATTTCGGCTGGATTCTTTATTATTAATCCATTTGAGGTTGTTTATTATGCAGGCGGCACAGCAAACGAATTTCGTCATTTTGCTGGAAGCTACGCAGTGCAATGGGAAATGATTAATTATGCGATTGATTATCAAATTCCAAGATATAACTTTTATGGCATTAGTGGTGATTTTTCAGAAGATGCAGAAGATGCAGGTGTGATAAAATTTAAAAAAGGCTATAATGCAGAAGTAATAGAATATGTCGGTGATTTTATTAAGCCTATAAACAAACCTGCCTATACAGTCTACTTAAAATTAAAGCAA
Q9ZFG3_9STAP/6-413 TTAACAACACTGGAATTTGAAGCTTTTACAAATAAAATGCCG---TACGCGCATTTTACACAAGCAGTAGGTAATTATGAATTAAAAACATCTGAAGGTACTTCAACACATTTAGTAGGGGTCAAAGATAATCAAGGTGAAGTATTAGCTGCGTGTCTGTTAACAAGTGTACCAGTTATGAAGAAATTTAATTACTTTTACTCAAATAGAGGACCAGTAATGGATTATGACAACAAAGAACTTGTTGACTTTTTCTTTAAAGAAATCGTGAGCTATTTAAAAAGTTATAAAGGATTATTC---TTTAGAATCGATCCTTACTTGCCATATCAACTAAGAGATCATGATGGCAATATTAAAAAATCATTCAAC---CGTGATGGTTTAATTAAACAATTTGAATCATTAGGT------------------TATGAACACCAAGGCTTCACAACTGGTTTCCACCCA------------------------------ATACATCAAATTAGATGGCATTCTGTACTTGATTTAGAAAGTATGGACGAAAAGACGCTCATCAAGAACATGGACAGTTTAAGAAAAAGA------------AATACTAAAAAAGTTCAAAAAAATGGTGTTAAAGTTCGTTTTCTATCTAAAGATGAAATGCCGATATTCCGTCAATTTATGGAAGATACTACAGAGAAGAAAGATTTCAACGATCGTGGCGATGACTTCTATTACAATAGATTAAAATACTTTGAAAAT---GTAAAGATTCCTTTAGCATATATAGACTTTGAAACTTACATTCCACAATTAGAAAAAGAACATGAACAATACAACAAAGATATTGCAAAAGCTGAAAAAGATTTAGAAAAGAAACCAGATAATCAAAAAACGATTAATAAAATAGACAACTTAAAACAACAAAGAGAAGCAAATGAAGCTAAATTAGAAGAAGCACTTCAACTACAACAAGAACATGGTGAT---------------------------------ACATTACCAATAGCAGCTGGTTTCTTTATTATTAATCCATTTGAAGTTGTATATTATGCAGGTGGTTCATCGAATGAATATCGTCACTTTGCAGGTAGTTATGCAATTCAGTGGGAAATGATTAAATACGCGTTAGATCACAACATTGACCGTTATAACTTCTATGGTATCAGCGGAGACTTCTCAGAAGATGCACCTGATGTTGGCGTTATTAAATTTAAAAAAGGTTACAATGCAGATGTTTATGAATATATTGGTGATTTCGTTAAACCAATTAATAAACCAGCGTACAAAGCATATACAACACTAAAAAAA
FEMB_STAAM/6-412 TTAACTGTTACCGAATTTGACAACTTTGTACAAAATCCATCATTGGAAAGTCATTATTTCCAAGTAAAAGAAAATATAGTTACCCGTGAGAATGATGGCTTTGAAGTAGTTTTATTAGGTATTAAAGACGACAATAACAAAGTAATTGCAGCAAGCCTTTTCTCTAAAATTCCTACTATGGGAAGTTATGTTTAC---TATTCGAATCGTGGTCCAGTAATGGATTTTTCAGATTTAGGATTAGTTGATTATTATTTAAAAGAGTTAGATAAATATTTACAGCAACATCAATGTTTATAT---GTTAAATTAGATCCGTATTGGTTATATCATCTATATGATAAAGATATCGTGCCATTTGAAGGTCGCGAGAAAAATGATGCCTTAGTAAACTTGTTTAAATCACATGGT------------------TACGAGCATCATGGCTTTACAACTGAGTATGATACA------------------------------TCGAGCCAAGTACGATGGATGGGCGTATTAAACCTTGAAGGTAAAACACCCGAAACATTGAAAAAGACATTTGATAGTCAACGTAAACGT------------AATATTAATAAAGCGATAAACTATGGTGTTAAAGTCAGATTCCTTGAACGTGATGAGTTCAATCTTTTCTTAGATTTATATCGTGAAACTGAAGAGCGTGCTGGATTTGTGTCAAAAACAGATGATTATTTTTATAACTTTATTGACACATATGGAGATAAAGTATTAGTACCATTAGCATATATTGACCTTGATGAATATGTGTTAAAGTTGCAACAGGAA---------TTGAATGACAAAGAAAATCGTCGTGATCAAATGATGGCGAAAGAAAACAAATCAGATAAACAAATGAAGAAAATTGCAGAATTAGATAAGCAAATTGATCATGATCAGCATGAATTATTGAATGCAAGTGAATTGAGCAAAACGGACGGCCCA---------------------------------ATTCTAAACCTTGCTTCTGGCGTTTATTTTGCAAATGCATATGAAGTGAATTATTTCTCTGGTGGTTCATCAGAAAAATATAATCAATTTATGGGACCATACATGATGCATTGGTTTATGATTAACTATTGCTTCGATAATGGCTATGATCGTTATAATTTCTATGGTTTATCAGGTGATTTTACGGAAAACAGTGAAGATTATGGCGTATACCGCTTTAAACGTGGATTTAATGTACAAATCGAAGAATTAATAGGGGATTTCTATAAACCAATTCATAAAGTGAAATATTGGTTGTTCACAACATTGGATAAA
P74894_9STRE/6-406 ATCGATGCACTTACTTTTGAAAAATTTGCAAATACTCAGAAA---AGACGTTCTTTTGAGCAAACCATTGAAATGGGAAATTTAAGAAAGAGTCGAAATTTTGATGTTAAATATTTTGCTCTTTTTCATTTGGAGGAAATAAAGGTTGTCGCACTTACATATACCCAAAAAATATTTGGTGGCTTGAATATGGGT------ATTTATTATGGACCTATTTTTAGTGAAGAA------AGATATCTTGCACATTTTTTGATTGAATTAAAAAAATATACGAAAAAAAATAATGTATTAGAA---CTTGATATTTTTCCATATGATGATTATCAATATTATGATGATGAAGGTAGGTTAATTCAAGATGGTAAT------ATTGAATTAAGAGATATTTTTGAAAAAGCTGGT------------------TTTACATATCAGGGGGATGAAGTTGGTTTTAAT---------------------------------AGTGAGCAAGTAACTTGGCATTATGTTAAAGATTTAACTAATCTTACATCAGAAAATCTACTAAATTCATTTTCAAAAAAAGGACGTCCG------------TTAGTAAAAAAATCTAATACTTTTGGAATAAAAGTTAGAAAGCTTAATAAAGATGAACTTCAAATATTTGCAAATATAACAAATGATACAGCCACTCGTCGAGGTTATAATGACAAAGGACTTGAGTATTATGAAAAATTTTTCGATGCATTTAAAGATAAGTCAGAATTTACTATTGCAACTTTGAATTTCCGTGAGTATTTAGGCAATATATTGGATGGTCGACATAGGCTTGAGAATAAAATTTCAATTTTAGGCACTAGGTTAGATAAAAATCCAAACTCTGAAAAAATAAAAAATCAACTTAGAGAGTTAAATAGTCAACGAGAAACATTTTTAATTAGAGAAGAAGAAGCGAAATCTTTTGTTAAGAAGTATGGTGATGAG------------------------------GATGTCGTTCTTGCGGGAAGCCTTTTTGTATATACTCAGCAAGAATTAGTATATCTTTATTCAGGCTCATATGTGGAGTTTAACAAGTTTTATGCTCCAGCACTTTTACAAGAATATGCTATGTTAAATGCATTAAAAAAAGGAATAAAATTTTATAATATGTTAGGTATTACTGGGAAATTTGATAATTCAGAT---------GGTGTTCTATGTTTTAAACAGAACTTTAAGGGGTATATAGTTCGTAAGTTTTCAAATTTTATTTACTACCCAAACCCTAGAAAATTAAAAGTTATACAACTAATTAAAAGC
O51533_BORBU/1-334 ATGACTATTAAAAAAATAAAAACAAAAGAAATGGAAGAAAAT------------TATCTTCAAAGCGAACTGTGGGCATTAATAAAAACAACAAAAAACAGTTATTGGAAAGCCATAGCATTTGAGAGCGAT---------GTTCTTGGCAAAATTGTTGTAATGCAAAGA---------AGACTATTTAAAAATTTTTACTTAGCATATATTCCGCATCCAGAATTCTCAAACAAAACTCTTGAAAACATTAATATTGATAAAATCAGTAAAAGTATTAAAGAATTTAGC------------ATAAAAATAAAACCCTACTTACATAAAAATACAATCTTTTTAAGATTCGATTTAATGTATTACTACCAA------AGAACACTGAATGACAAATACTCTCCATTAAAA------------------ACTAAAATCAAATATCTAAAAAAATCCTTTGAT---------------------------------GACATACAACCCGCAAACACAACAATATTAAACTTAAATAATTCTCTTGAAGAGATTTTGCTTAACATGAAAAAAAAAACAAGATATAAC------------ATAAAGCTCAGCACAAAAAAAAATCTAAATATAATAATAGATGATAAATTTAAACATTTAAGTGAATTTTACAAGCTATACAAAGAAACTAGCAAAAGAGATAAATTTACTATTCACTCAGAAGAATATATACAAAACCTAATTCAAATATTCAAACAA------------------------------------------------------------------------GACAAA---------------------------------------------------------------------AAT---------------------------------------GCTCAAATAAAATTGATAATTGCATTTTACAATAAC------------------------------------ATAATTATTTCTGGCATAATAGTGGGAATTTACAAAGAAAAAGCAGTCTATCTTTATGGGGCTTCAAGCAAGGAATATAGAAATTTAATGCCCAATTACGCTGTACAATTTAAAGCAATAGAAATGTTAAAAAAATTAGAAATAAAAGAATATGATTTATTAGGAATTCCCCCAATTGCAAATAAAAACCACCCCTTATATGGTCTTTTTAGTTTTAAAACAGGATTTGGAGGCAATATTATTCATAGAATTGGTTGTTATGATTTTACTTACAAAAATTTTATTTATAAGATTTATGCAAATCTTGAAAAA
O83784_TREPA/19-461 CGTATCCCTCTGCATACAGAGCGTACCGGGAGCGCACGGCAGGTAATGGAGCTTTTTGGGAGATATCTGGATCCGGTGCACGGGGAGCAGTACAATGGGTGCCCCATGTTCGTAGTTACCGTGCAAAAGTGGACGCAGGAGACGTGGACTGCAGAAACGTTTTTACAAAGTCCTGCGTGGGCGCACTTCAAGCGAGCGTACGGCTGGCAGACGTACGTGTTCAGCGTGCATGTGCGCCCGGATGCAAACACTGGGGGAGAAAAACACTTTCCCCTGCTCATTCTGTGCAAGAATATTAAGCCCTTTGGCGTGTTTGCGTATGCGCCGGGTGCTCCCCCGTATCTTCAGGACGATCAGATTCCGTCACGGCAGATGGCGCGCGCACGTGCCAGTCTGCTACGTGAGTTAACGAGCGCGCTACTTCCCTTTTTCGTGCGTAAGCCGTTCCTCGTGCGGTTTGATCCCCCGTGGGGGTGGGCTGCTGCGGTGTGCTCGCTCCCTTCTCTTGCATCCTCCTCTACGCATTGCGCGGTGGGAACAGAGATGGAGCTCTTTACGCGAGAGCTCCACGCGTGTGGACTACGGCGCGCTGCTTGTAACGTGCAGCCTCAGGATACATTGCTGTTGGATATGCGCCCCGCGCGGGAAGATATTTTTGCTGCTTTCAAACCAAAATGGCGCTACAACGTTCGACGTGCGCAAAAGCACGGTGTGCGTGTGGCGCGTTTTGATACGCTCGCGCAGGAGGGTTCTCCGGGTAGTCTGCGCGCGGCGGTGGATGTGTTTTACGCGCTGTACCAAAAAACTGCGGCGCGTGATCGCATTGCCATCCACACCCGTCAATATTATCGCGATTTTTGCACCGCATTTGCAGCACAGGGGATGCTGGTGCTCTGTCTTGCCTATGCTCCGCGTGCAGCACTGCGGGTGCGTATTGCAGGAAAAGACACACCGAAGAACATAGAGACACCCCATCCCCCGGCATCGGAAGACAGAGAATTAGGGTGCGCTGATGAGCAGGCAATTGCAGCTTTGGTATTGTTGTGTTTTGACACGTGCGCAACTTATGTGTATGGAGCTTCTGACTATTCAGCACGCCATCTTATGGCACCGTATGCGCTGCAATGGTATGCAATTCAAGAAGCGCGTGCGCGCGGCTGTCTTTGGTATGATTTTTACGGTATTCCGCCAACGGACGATGTGCGTCACCCAATGCACGGGTTGTACCGTTTTAAAACAGGTTTTGGCGGATTCGTATTCCATCGTGTAGGAAGCGTAGATATGCCGGTTCGGCAATTGCATGCTGCGGCATATGCATGTGCTGAGCGT