EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02106 alignment
(3 sequences with 1788 bp)


FANCC_BOVIN/1-560 ATGGCTGAAGACTCAGCAGGCCTTCCTTCTAATTATCAGTTTTGGATGCAGAAACTTTCTGTCTGGACCCAGGCCTCCACTTTGGAAACCCAGCGAGACATCTGCCTTCACCTGCCACAGTTCCAGGAGTTCCTGAGGCGGATGTATGAAACCTTGAAAGAGATGGATTCAAATGCAATCATTGAAAGATTCCCCACAATTTGCCAGCTGTTGGCAAAATCTTGCTGGAGTCCTTTTATCTTAGCTTACGATGAAAGCCCCAAAATCCTAATATGGTGCTTGTGTTGTCTGATTAAGAAAGATCCACAGAATTCTAGAGAATCAAAACTTAATTCCTGGACACGGAGGTTGTTATCTCATATAGTTTCCACATCCAGATTTGATATAAAAGAAGTTGGTCTTTTTAATCAAGTTCTTGGGTATGCACCCACAGACTACTATCCTGGTTTACTTAAAAATATGGTTTTATCATTAGTGTCTGAACTCCGAGAGAATCATCTTAATGGATTTAGCAGTCAAAGACGA---TGTCCTGAACGAGTAAGGTCCCTGTCACGAGATCGTGTCCCACTTCTTACTTTGCCAGATTTTGAACCACTGGTAGAGGCTCTGCTCACCTACCATGGACATGAACCTCAGGAAGTACTCTGCCCTGAGTTCTTTGATGCTGTGAATGAGGCTTCTTTGCTGAAGAAGATTTCTCTCCCCACGTCAGCTATACTCTGCCTCTGGCTTCGGCACCTTCCCAGCCTTGAAAATACAATGCTTCATCTTCTTGAAAAGCTCATCTCCAGTGAGAGAAATTCTCTGAGAAGGATCAAATGCTTTATGAAAGACTCACTGCGCCCTGAAGCTGCTGCCTGCCACCCCGCCATTTTCAGAGTTGTTGATGAAATATTCAGGTCCGCACTCCTGGAAACCGATGGAGCCCCAGAAGTACTAGCCGGCCTTCAGGTGTTTACACGATGCTTTGTAGAAGCTCTGGAAAAAGAAAACAAGCAGTTGAAGTTTGCACTCAAGACCTACTTTCCTTATGCTTCTCCAGCTCTTGTCATGGTGCTCCTCCAACACCCGAAAGATATTCCGCAGGGACTATGGCACCAGTCACTGAAACATATCTCTGAAATGCTCAAAGAAATAGTTGAAGAC------CATGGGTCCTATGGAGGCCCCTTTGAGAGCTGGTTCTTGTTTGTTCACTTTGGAGGATGGGCTGATATCACGGCTGAGCAGTTACTGATGTCAGAAGCTGAGGCTGAACCCCCAGAGGCACTGCTGTGGCTCCTGGCTTTCAGCTGCAGCCCAGGCGCCGGGCATCAGCAGAGAGCGCGGACCATGGTGGAGGTGAAGACAGTGCTTGGCTGCCTCACGAAGCTGTTCAGGAGTCCAGCCCTCTCGGCCAGGGATTTGCAGGCTGCAGCTGGAGAGAACCTAGGTGGAGACCCCAGACCGCCTGCTTGTCAGCAGCTGGTCAGACGCCTCCTCCTGCACTTCCTGCTCTGGGCTCCTGGAGGACACACGATTGCCCGGGAAGTCATCACCCTC---------------------------------------------------------------------------------------------------ATGGCTCAGACAGATGCGATAATGAACGAGATTATTGGCTTCCTGGACTATACTTTGTACAGATGGGATCATCTTTGCGTGGAAGCCCATAGGTCGAGAAAACTGGCCAGAGAGCTCCTCACAGAGCTGCGAGAGCAAGCC
FANCC_HUMAN/1-558 ATGGCTCAAGATTCAGTAGATCTTTCTTGTGATTATCAGTTTTGGATGCAGAAGCTTTCTGTATGGGATCAGGCTTCCACTTTGGAAACCCAGCAAGACACCTGTCTTCACGTGGCTCAGTTCCAGGAGTTCCTAAGGAAGATGTATGAAGCCTTGAAAGAGATGGATTCTAATACAGTCATTGAAAGATTCCCCACAATTGGTCAACTGTTGGCAAAAGCTTGTTGGAATCCTTTTATTTTAGCATATGATGAAAGCCAAAAAATTCTAATATGGTGCTTATGTTGTCTAATTAACAAAGAACCACAGAATTCTGGACAATCAAAACTTAACTCCTGGATACAGGGTGTATTATCTCATATACTTTCAGCACTCAGATTTGAT---AAAGAAGTTGCTCTTTTCACTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTTAAAAATATGGTTTTATCATTAGCGTCTGAACTCAGAGAGAATCATCTTAATGGATTTAACACTCAAAGGCGAATGGCTCCCGAGCGAGTGGCGTCCCTGTCACGAGTTTGTGTCCCACTTATTACCCTGACAGATGTTGACCCCCTGGTGGAGGCTCTCCTCATCTGTCATGGACGTGAACCTCAGGAAATCCTCCAGCCAGAGTTCTTTGAGGCTGTAAACGAGGCCATTTTGCTGAAGAAGATTTCTCTCCCCATGTCAGCTGTAGTCTGCCTCTGGCTTCGGCACCTTCCCAGCCTTGAAAAAGCAATGCTGCATCTTTTTGAAAAGCTAATCTCCAGTGAGAGAAATTGTCTGAGAAGGATCGAATGCTTTATAAAAGATTCATCGCTGCCTCAA---GCAGCCTGCCACCCTGCCATATTCCGGGTTGTTGATGAGATGTTCAGGTGTGCACTCCTGGAAACCGATGGGGCCCTGGAAATCATAGCCACTATTCAGGTGTTTACGCAGTGCTTTGTAGAAGCTCTGGAGAAAGCAAGCAAGCAGCTGCGGTTTGCACTCAAGACCTACTTTCCTTACACTTCTCCATCTCTTGCCATGGTGCTGCTGCAAGACCCTCAAGATATCCCTCGGGGACACTGGCTCCAGACACTGAAGCATATTTCTGAACTGCTCAGAGAAGCAGTTGAAGACCAGACTCATGGGTCCTGCGGAGGTCCCTTTGAGAGCTGGTTCCTGTTCATTCACTTCGGAGGATGGGCTGAGATGGTGGCAGAGCAATTACTGATGTCG------GCAGCCGAACCCCCCACGGCCCTGCTGTGGCTCTTGGCCTTCTACTACGGCCCCCGTGATGGGAGGCAGCAGAGAGCACAGACTATGGTCCAGGTGAAGGCCGTGCTGGGCCACCTCCTGGCAATGTCCAGAAGCAGCAGCCTCTCAGCCCAGGACCTGCAGACGGTAGCAGGACAGGGCACAGACACAGACCTCAGAGCTCCTGCA---CAACAGCTGATCAGGCACCTTCTCCTCAACTTCCTGCTCTGGGCTCCTGGAGGCCACACGATCGCCTGGGATGTCATCACCCTG---------------------------------------------------------------------------------------------------ATGGCTCACACTGCTGAGATAACTCACGAGATCATTGGCTTTCTTGACCAGACCTTGTACAGATGGAATCGTCTTGGCATTGAAAGCCCTAGATCAGAAAAACTGGCCCGAGAGCTCCTTAAAGAGCTGCGAACTCAAGTC
FANCC_MOUSE/1-591 ATGGCTCAGGAGTCTGCAGACCTTGCTTCTGACTGTCAGTCTTGGCTGCAGAAGCTTTCTGCATGGGAACAGGCCTCTTCTGAGGAAACCCAGAAGGACACTTGTCTTCACTTGTCCGGGTTCCAGGAGTTCCTGAGGCAGATGTATGAAATCTTGAAGGAGATGGATTCTGATGCAATCCTGGAAAGGTTCCCCACAATTGGTCAACTGTTGGCAAAAGCTTGTTGGAATCCTCTCATCTTTAGCATATATGAAAGCCAAAAAATTGTAATATGGTGCTTATGTTGTCTGATGAACAAAGAACCTCGGACTTCTGCAGAGTCAGGACTTAACTCGTGGATCCGGGGTTTGTTATCTCATGTACTTTCTGCATTCAGATTCGACATGAAAGAAGTTTGTCTTTTTACCAAAAGTCTTGGATATGAGTCTATTGATTACTATCCTAGTTTGCTTAAAAATATGGTTTTGTCATTAGTGTCTGAGCTCAGAGAGAGTCATCTTAATGGACTGAGCACTCAAAGTCGGATGGCTCCTGAGCGCATGATGTCCCTGTCAGAAGTTTGTGTCCCTCTTGTCACTCTGCCTGATATGGAACCCCTGGTAGAGGCTCTACTCACCTACCATGGACATGAGCCCCAGGAAGTCCTGGCTCCTGAGTTCTTCGAAGCTGTAAATGAGGCCTTCTTGTCGGAAAAAATTGTTGTACCCACGTCCTCTGTGGTCAGCCTCTGGTTTCGGCATCTCCCCAGTCTTGAAAAAGCAACGCTGCATCTTTTTGAAAAGCTTTTCTCCAGCAAGATAATTTGCCTGAGAAGGATGGAGTGCTGTATAAGAGAGTCATTCCTGCCTCAA---GCAGCCTGCCAACCTGCCATCTTCAGAATTGTTCATGAAATGTTCAGGTTTGTGCTGCTGAAAACTGACGGAGCCCCAGAAGTACTAGCTGCTCTTCAGGTTTTCACATCGTGCTTGGTAGAAGCTCTGAAAAAAGAAAACAAGCAGCTGACGTTTGCCCTCAGGACCTACTTTCCTTACGGTGCTCCATGTCTTGCTGCAGCGCTGTCCCAGCACCCTGAAGCAATCCCACAGGGACACCGGCTCCAGCCTCTGCTGCACATTTCCCAACTCCTCAGAGAAGCAGTTGAAGACTGTACTCGTGGGTCTCCGCGAAATCCCTTTGAGAGCTGGTTTTTGTTTGTTCACTTTGGAGGATGGGTTGACCTGGCTGTGGCAGAGTTACTGCTGAGG---GAGGAAGCTGAGCCTCCTGCTGGCCTGCTGTGGCTCTTGGTGTTCTATTACAGCCCACAGGATGGGAGTCAGCAGAGAGAGCAGAGCATGGTGGAGCTGAAGGTATTAATCAACCGTCTCCTGATGCTGCTCAGAAGCGGCCCCCTCTCAGCTACTGATCTGCAGGAAGCAGCT---GAGAGTCCCAGTGGAGACCCCAGACCACCTGTATGTGGACAGCTGGTCAGACGCCTTCTTCTTAGTCTCTTGCTCTGGACCCCAGAAGGCCATGCAATTGTCTGGGAAGCTGTCACCCATGGTCCGACTTTTGAGATCACAGGCCCAGGATGCTGCCCCAGGATATGGAGATCCACAAAGCCACAGCACAGACCCAGAGCCCACCTGTGCTGTACAGAGATGGCCCACACGGATGCTGTAATCCATGAGATTATTGGTTTTCTTGACCAGACCTTGTACAGATCACAACATCTTTGTGTTGAAGCC------TCGAGAAAACTGGCCAGAGACCTCCTAAAGGAGCTGCAAGCCCAGGTC