EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02095 alignment
(28 sequences with 30 bp)


Q40376_MEDTR/87-96 CATCCCGTCTACAAGCCATCTGTAGAGAAG
PRP1_SOYBN/201-210 CCTCCTATTTACAAGCCACCAGTTTACAAG
Q43414_CICAR/60-69 CCCCCTATTTATAAGCCACCAGTAGAGAAA
PRP1_SOYBN/231-240 CCACCGGTGTACAAGCCCCCTGTTAAGAAA
PRP_MEDSA/67-76 CCACCTGTGTACAAACCCCCTGTCGTGAAA
PRP1_SOYBN/91-100 CCACCGGTTTACAAGCCTCCAGTTTATAAA
Q40376_MEDTR/207-216 CCTCCGGTGTACAAGCCACATGTTGAGAAG
Q40376_MEDTR/257-266 CCTCCGGTGTACAAGCCACTAGTTGAGAAG
Q40376_MEDTR/217-226 CCCCCAGTAAACAAACCTCCAGTAGAGAAG
PRP_MEDSA/42-51 CCACCGGTGTATAAGCCACCAGTTGAGAAA
Q40376_MEDTR/292-301 CCACCAGTTGAGAAGCCACCAGTTGAGAAG
Q40376_MEDTR/392-401 CCTCCAGTGCACAAGCCACCAGTTGAGAAA
Q40376_MEDTR/512-521 CCTCCAGTGCACAAGCCACTTGTTGAGAAA
Q43414_CICAR/160-169 CCCCCTGTCTACACACCACCTGTAGAGAAA
Q40376_MEDTR/472-481 CCTCAAGTGCACAAGCCACCAGTTGAGAAA
Q40376_MEDTR/532-541 CCACCAGTTCACAAGCCTCCATTCGAGAAG
Q43414_CICAR/40-49 CCGCCTGTTTACAAGCCACCAATAGAGAAA
Q43414_CICAR/170-179 CCTCCGGTATACAAGCCACCAATTGAAGAG
PRP1_SOYBN/71-80 CCTCCAGTTTATAAGCCACCCATTTACAAG
Q40376_MEDTR/77-86 CCACCTGCGTACAAACCTCCAGTAGAGCAC
Q40376_MEDTR/502-511 CCTCCGGTGTACAAGCCACCAGTTGAGAAC
Q40376_MEDTR/27-36 CCTCCCGAGTATAAACCACCAGTTGAGAAT
Q43414_CICAR/190-199 CCACCGGTTTACGGGCCTCCATATGAGAAG
Q40376_MEDTR/267-276 CCCCCACTTCACAAACCTCCAGTAGAGAAG
Q40376_MEDTR/167-176 CCCCCACTTCACAAACCTCTAGTAGAGAAG
Q40376_MEDTR/442-451 CCTCCACTTCACAAACCTCAAGTGGAGAAG
Q40376_MEDTR/452-461 CCAACTGAATACAAGCCACCAATTGAGAAG
Q40376_MEDTR/57-66 CCTCCAACCCACCATCCACCAATCGAAAAA