EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01861 alignment
(6 sequences with 1140 bp)


O28662_ARCFU/7-368 AGAAGGCCTTTAAGCTGTTCCTTGAGAAGTTCAAGCCAGAATCCTATCGCCACTACG------------TTCTTGACAGGGGGTAAAATGGACAGGATTGTCAGGCAGATACTGGTAAAGCTCCTTGGAGGA---GAAAGAAGCGTTTACGAGCTAATTTACTATCAGGATGCATCGCTGAGGGAGTTCTTTGAACTCCTCAACTCTTTGAGGGATGAGGGGCTGATTGAAGTTGAGAGCGGGAAA...GTGAGGATTACCGAGAAGGGCAGGGAGGTTGCCGAGAAAGAGAGGCTAAAGTTCTGCGGAGAT---GTTGAGTGTGAGTGCTGTGAGGGTACGGGGCTTTCAATCAACCCCTATTTTAAGGAAATTTTGCAGAAGTACTCCGAAATAGCCAAGGACCGCCCCGAAACCATTGAAGTCTATGATCAGGGATTCATCAGCCTTGAAGGTGTGATAAGGAGAGTTGAGTTCGTTTACGACAGAGGAGATTTGAATGGCAGA---ATTTTTGTCGTCGGC---GATGATGATCTATTCGGCATTGCCGCATCGCTGACGGGGATGCCTGAGAAGGTTGCTGTTGTGGACATCGATGAGAGGCTAATCAACTTCATAAACAGGGTGGCTGAGGAGTATAGCCTCAAC---GTTGAGGCCTTTGTTTATGACGTCCAGCAGGCTTTTCCGGACGAGCTCAAAAGGAAGTTTGACGTCTTCGTCACCGATCCGGTAGAGACAATCCCCGGATTGAAGCTCTTCCTTTCGAGGGGGGTTTCAACGCTTAAGGGCGTTGGTGGAGCTGGATACTTCGGCATAACAACCCTTGAAGCTTCGAGAAGGAAATGGTACGAGATTCAGAGGATGATTCAC---GACATGGGCTTCATCATCACTGACCTCAGGAGGAGGTTCAACGTTTATCCTGAG---GATGAGAAGAACTTCTTCAGATTTCAGGAGAAGCTGCCAATCGTGAGGCATCTGCAG------GCGAAGGTGGACTTCAACTGGTACAACTCAACTCTTTTCAGAATTGAGGCCGTGAAG------------GAGCCCAAGCCCATCGTAGAGGGAGAGATGATAATAGACGAGAAAGTTTACAAGGACGACGAGAGCTGGGCG
O67635_AQUAE/4-354 CTGGAGAGGATAGCCAAGGAAGTTCAGGAGGAGACGAAGGTAAGGCTTCAC---------------------------------------GCGAGGAACGTAGAGAGAGTTCTTCAGGCACTTTTAAAG------ACGGGAGATTTCTGGAAGATAGTTGATTACTCAGACCTGCCTGTTCCTGCGGCATCGGGGATTATCAAAAAGTTTTTAGACGAAGGAATTGTGTTTATTGATGAAAACGAAaacATCCTCTTTACCCAGAAGGGGCTTGACTTAGTAAAGGAGCTCGGGATTGAACCCTTTGAAGAG---CACAAGTGCAGGGCTTGTGAAGGAAGGGGAATACCCTTCTACGACGATAAA---GAACTTTACAGAACTTTCGTTGAGATAGCCAAAGACAGACCAAAACCCGTTCAGCAGTACGACCAGGGAAGCGTTACTCCCGAAACTACTGTATCCAGAGTACTCTTTTTAGATAGCAGGGGAGACCTCAGGGGTAAGGAAATTATCGTAATGGGAGCGGAAGACGACCTCACTGGACTCGCAATAGCCCTCACGAGAAAGGCAAAAAGGGTTCTGATAATAGACATAGACGAGAGATTGATAGACTTTGATAACAGAATTATAAAGGAACTCGGAATAGACAACGCGGAAGCCATGGTGTGGGATCTTAGAAACCCCTATACTGAAGACTTTTTAGGGAAGTTTGACGTATTTATAACAGATCCCCCCGAAACTTTCGCAGCGTTTAGGGCGTTTATAGGAAGGGGAATAGCCACGCTCAAGGACGCGGGGTGTGCGGGCTACTTTGGACTCACTTTAAGAGACAGTTCCATATTCAGGTGGAAGGAGTTTCAGGAAATACTCATTAACGAGTACGGAGTTGTTATAACCGACATAATTCAGGACTTCAACGATTACATGAACTGGGAATACCACCCCGAAACTAGAGCAGCCCAGATAGCACCTGTAAAGAAG------------------AATCCCACGGACATATGGTATCGCTCCGCTTGGTACAGGATAGAAACGCTTCCC------------GGGTTC---AAACGCTGGAACGAACCTATATCCGAT---GAGGTGTTCTACTTAGATGAAGAAGGCTCTACT
O58459_PYRHO/1-348 ATGAAAGAGATTGTTGAGAGGGTAAAAACAAAGACTAAGATTCCCGTTTAT---------------------------------------GAGAGAAGTGTAGAAAACGTTTTATCAGCAGTTTTAGCG------AGTAGTGATATATGGAGGATTGTAGATCTAAGTGAAGAACCCCTCCCACTCGTTGTCTCGATTTTAGAAACCCTTAACGAGCTTGGATACGTAACTTTTGATAAGGGA---...GTTAAGCTTACAGAAAAGGGAGAAGAGTTAGTAGCTGAATACGGAATTGGAAAGAGATATGAC---TATACCTGCCCACACTGTCAGGGTAAGACCGTTGATCTTCAAGCCTTTGCT---GATCTGCTTGAGCAGTTTAGAGAGATAGTAAAGGAGAGACCAGAGCCTTTACATGAGTACGATCAAGGTTATGTAACCCCGGAAACCACAGTTGCTAGGGTAATCTTAATGCACACAAGAGGGGACTTAGAGAACAAGGAGGTATTTGTCCTGGGG---GATGATGATTTAACGAGCATAGCCTTAATGCTTTCAGGACTACCCAAGAGGATAGCCGTTCTGGATATAGATGAGAGGCTGATAAAGTTCATAGAGAAAACCGCGGATGAAATAGGGTACAATGACATAGAAATATTTACCTTTGATCTTAGAAAACCCCTGCCTGAGTATGCCCTCCACAAGTTTGACACGTTTATAACGGATCCACCTGAAACGATTAAAGCGATAAGGGCATTCGTTGGAAGGGGAATTGCAACGCTTAAAGGTCCTAGATGTGCTGGATATTTTGGAATTACAAGGAGAGAGAGCTCTCTCGATAAGTGGAGGGAGATTCAAAGAATGCTCATCAATGAATTTAATGTTGTAATAACTGACATAATAAGGAACTTTAATGAGTACGTGAATTGGGGATACGTTGAGGAGACGAAGGCTTGGAGGCTAATACCCATAAAGAAG------------------CTTCCTGAATACAACTGGTATAAGAGTTACATGTTCAGAATTGAAACTTTAGAA------------GGATCA---AAGGGATATGAGGAAGAAATAACTGAA---GAGGACATTTACAACGACGAAGAAGCATCAACA
Y1273_METJA/1-349 ATGGAAAGAATCTTAGAGAAGGTTAGAGCAAAGTCAGAGATTCCAGTATAT---------------------------------------GACAAATCAATTGAGAATGTTTTGTCAGCTATTTTAACA------ACCAACGATTTTTGGAAGATTGTTGATTTAAGTGAGGAACCATTACCTTTAGTTGCTGATATTATAAGAATTTTAGAAGAGGAGGGATTAGTAAAGATAAGTAATGGA---...ATAGAATTTACTGAAAAAGGAAATGAATTTATAAAATCCTATGGAATTGGAGCTAAAGATAAT---AGTGTTTGTGAATGCTGTGAAGGGAGGGGGGTTTCTTTAAAGAACTACCAA---GATTTATTAGAGAGATTTAAAGAGATTGTTAAAAATAGACCAATGCCAAAACACGAATACGACCAAGGTTTCGTTACACCAGAATGCACAATTTCAAGAATCGCTTTAATGAACTCAAGAGGAGATTTATTCAATAAGGATGTTTTAGTTTTAGGG---GATGATGACTTAACAAGTATTGCTTTAATGCTCTCAAATCTTCCAAAAAAAATAGTTGTTGTTGATATTGACGATAGATTAATCAACTTCATAAAAGAGGTTGCTGAGCAATTAAATTACAAAAATATAGAAGTTATAACCTTAGATTTAAGAAAACCACTTCCAGAGAAATACAGCAGAGCGTTTGATACTTTTATAACAGACCCACCAGAAACAGTTTATGCTGTAAAAACATTCATTGGTAGAGGAATATCAGCATTAAAAGGAGAGAGAAGAGCTGGTTACTTTGGAATTACAAGAAGAGAGAGTTCATTGGATAAGTGGAGAGAAATTCAAAGAACATTGATAAACGACTTCAATGTGGTTATAACTGACATAATAAGGAATTTCAACCACTATGTAAATTGGGGTTATGAAGAAGAAACAAGAGCTTGGAAATTAGCTCCTGTAAAGAAA------------------AAACCAGAAGATATTTGGTATAAATCCTATATGTTCAGAATAGAGACATTGAAG------------GATAGC---AGAGGATTTGAAGAAGAAGTTGATGTTGGAGATGAGTTATACAACGATGCTGAAAGTTCAACA
YSC2_THETH/6-343 CTGGTCCAGGTGGCGGAAGAGGTGCGCCGGGCCACGGGCCTTCCCGTGGGC---------------------------------------TGGCGGGACGTGGAGAGGACCCTTGGGGCGCTCCGGGCA------ACCCGGGACCTTTGGGAGGCCGTGCGGCTTTCCCGCGTGCCCTTGCGCTTCCTCGTGCCCATCTGGGAGGGCCTCGCCCGGCGGGGGCTTCTCCGGGTGGAGGAGGGG---...---------------------CTGGACCTCCTGGCGGAGGTCCCGGCGCCCCGCCCTGGGGAG---GCGGCCTGCCCCGCCTGCGAGGGCCGGGGGCTTGTGGGGGAGAGGCTTCCGGGCCGGGCGGCGGAGCGGTTTTTGGCCTGGGCCAAGGAGCGGCCCGAGGCCATCCAGGACTTTGATCAGGGGTACGTGACCCCGGAGTCCACCCTGGCCCGGGTGGCCTTGGCCTGGAACTGGGGCGACCTCGAGGGCAAGGAGGTCCTGGTCCTGGGG---GACGACGACCTCACGGGCCTCGCCGCCGCCCTCACGGGCCTGCCCAAGCGGGTGGTGGTCCTGGACGCCGACCCCAGGATCGTCCGCTTCCTGGAGCGGGCGGCCAAGGCCGAGGGGCTTCCC---CTCGAGGCCCACGTCCACGACCTCCGGGAGCCTCTGCCCGAGGCCTGGGTCCACGCCTTCCACACCTTCTTCACCGACCCGGTGGAGGGGCCTTTGGGCCTCCAGGCCTTCGTGGGCCGGGGGCTTCTGGCCCTTGAGGGGGAGGGGTGCGCCGGCTACGTGGGCCTGACCCACGTGGAGGCGAGCCTCGCCAAGTGGGCCGACTTCCAGCGCTTCCTCCTG---GAAAACGGGGCCGTGATCACCGAGCTTCGGGACGGGTTCCACGTCTACGAGAACTGGGGGTACATTGAGCAGATGCGGGCCTGGCCCTGGCTTCCCGTCAAGCGC------------------CGCCCCGAGAAGCCCTGGTACACCTCGGCCCTGATCCGGCTGGAGCTCCTC------------------------CGCCGGGCGGACCTGGAGAACGCGCGGGTGGAGGGGGACCTCCAGGACGAGGAGGCCACCTAC
Y675_METJA/7-379 ATTGGAAAAGGTAAAGTAGAAGTTAATGAAAAGACGAAGTTCTCAATACTTTTAAACAATGTTGCTAAAAAAGCTGATATTGCTGAGGGAAAAAGAGCTGTTGAAGATATAATTAGAGTTATCTATAGGCATCAGCCAATATCAACAAAAAAGATTGCTCAAAAAACGAGATTGCCCTTACCAATAGTTGCCAAGGTTAGAACTATCTTAGAGAGAGAAAAAATATTAAAGAGAACTGAAAGAGGA...GCAGAGCTAACAGATTTGGGTAAAGAATTTGCTGAAAACTTTTTAAAATTGAAGTATAAAAAATCTCTTACCTGCAAAACTTGTAATGGTAGAGGTATTGTGTTAGATGAATTTTTTGAAGATATTTTAAATAAGGTTAGAGTTTGGGCTAAGAGAAGGCCTTTAGTTGATACAACTATAGACCAATCCTTTGCAACACCAGAAACATCAACTTATAGGGCTGCTTTGATGTATGAAAGAGGAGATTTAGAAGGAAAGAGAATTTTATTTGTTGGA---GATGATGACTTAACTTCTTTACCAACCGCTCTAACAAATATGGCTGAGGAAATAGCTGTTGTGGATATAGATGAGAGGATTTTAAAGCTTATAGAAAAATTTTCACAAAAAGAAGGAGTTAAA---ATTAAAACAATTAAGCATGATTTAAGAAACCCACTACCACAAGATTTAAAGGAGAGATTTGATGTTATCTCAACAGACCCGCCATATACTGTTGATGGCTTAAAGTTATTTTTATCAAGAGGGATAGAAGCGTTAGGAAAAGAAGGG---ATTGCTTATCTTTCCTATTCTCACAAACCA------ATAGATGAGTGGCTCTCTATTCAAAAAGCAATTACA---AATATGGGTTTTGTTATCTCAGAGTTAATTCCAAACTTTAATTATTATGAAGGTAGTGAGATAATTGCAAACACAACATTTATAGCGAGATTGGTTGGGAAAAATTTGAAGATAAATATTGGAGACACTGAGAAGATATATACTGGTTTAGTTAAGCCAGTTATAAGATATTATAAATGCCTAAAATGTGGAAAAATCCATAAAGTTGGAGAAGAGGTTAAGAAAGTTGAGGATTTAGTTTGTGAGTGTGGAGGGAAGAAA