EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01589 alignment
(5 sequences with 1515 bp)


Q08359_EEEV/740-1240 AAGCCGACGAGGGCAGACGACACCTTGCAAGTGCTGAATTATCTGTGGAACAACAATCAAAACTTTTTCTGGATGCAGACGCTTATCCCACTTGCAGCGCTTATCGTATGCATGCGCATGCTGCGCTGCTTATTTTGCTGTGGGCCGGCT------TTTTTACTTGTCTGCGGCGCC------TTGGGCGCCGCAGCGTACGAACACACAGCAGTGATGCCGAACAAGGTGGGGATCCCGTATAAAGCTTTAGTCGAACGCCCAGGTTATGCACCCGTTCACCTACAGATACAGCTGGTTAATACCAGCATAATTCCATCAACTAACCTGGAGTACATCACCTGCAAGTACAAGACAAAAGTGCCGTCTCCAGTAGTGAAATGCTGCGGTGCCACTCAATGTACCTCCAAACCCCATCCTGACTATCAGTGTCAGGTGTTTACAGGTGTTTACCCATTCATGTGGGGAGGAGCCTACTGCTTCTGCGACACCGAAAACACCCAGATGAGCGAGGCGTATGTAGAGCGCTCGGAAGAGTGCTCTATTGACCACGCAAAAGCTTATAAAGTACACACAGGCACTGTTCAGGCAATGGTGAACATAACTTATGGGAGCGTCAGCTGGAGATCTGCAGATGTCTACGTCAATGGTGAAACTCCCGCGAAAATAGGAGATGCCAAACTCATCATAGGTCCACTGTCATCTGCGTGGTCCCCATTCGATAACAAGGTGGTGGTTTATGGGCATGAAGTGTATAATTACGACTTTCCTGAGTACGGCACCGGCAAAGCAGGCTCTTTTGGAGACCTGCAATCACGCACATCAACCAGCAACGATCTGTACGCAAACACCAACTTGAAGCTACAACGACCCCAGGCTGGTATCGTGCACACACCTTTCACCCAGGCGCCCTCTGGCTTCGAACGATGGAAAAGGGACAAAGGGGCACCGTTGAACGACGTAGCCCCGTTTGGCTGTTCGATTGCCCTGGAGCCGCTCCGTGCAGAAAATTGCGCAGTGGGAAGCATCCCTATATCTATAGATATACCCGATGCGGCTTTCACCAGAATATCTGAAACACCGACAGTCTCAGACCTGGAATGCAAAATTACGGAGTGTACTTATGCCTCCGATTTCGGTGGTATAGCCACCGTTGCCTACAAATCCAGTAAAGCAGGAAACTGTCCAATTCATTCTCCATCAGGTGTTGCAGTTATTAAAGAGAATGACGTCACTCTTGCTGAGAGCGGATCATTTACATTCCACTTCTCCACTGCAAACATCCATCCTGCTTTTAAGCTGCAGGTCTGCACCAGTGGAGTTACCTGCAAAGGAGATTGCAAGCCACCGAAAGATCACATCGTCGATTATCCAGCACAACATACCGAATCCTTTACGTCGGCGATATCCGCCACCGCGTGGTCGTGGCTAAAAGTGCTGGTAGGAGGAACATCAGCATTTATTGTTCTGGGGCTTATTGCTACAGCAGTGGTTGCCCTAGTTCTGTTCTTCCAT
POLS_ONNVG/743-1246 AGGACTGCAAAAGCAGCATCGTACTACGAAGCTGCAACATACCTCTGGAATGAGCAACAACCATTATTTTGGTTACAGCTTCTAATCCCTCTGTCAGCTGCAATTGTTGTGTGTAATTGCCTAAAACTTTTACCATGCTGCTGCAAAACATTGACTTTTTTAGCCGTCATGAGCATCGGTGCCCGCACTGTGACCGCGTACGAGCACGCAACAGTGATCCCGAACACGGTGGGAGTACCGTGTAAGACTCTTGTTAGCAGACCAGGGTACAGCCCTATGGTCTTAGAAATGGAGCTACAGTCGGTCACTCTGGAACCAGCATTATCCTTGGATTACATTACGTGTGAGTATAAAACAATCACACCGTCCCCGTACGTAAAATGCTGTGGTACAGCTGAATGTAAGGCCAAGAACCTGCCAGATTATAACTGCAAAGTATTCACAGGCGTCTACCCATTTATGTGGGGAGGAGCATACTGCTTCTGTGACGCAGAGAACACACAGCTCAGCGAGGCACACGTTGAGAAATCAGAATCATGCAAAACTGAGTTTGCATCAGCCTACAGAGCCCACACAGCTTCAGTATCAGCTAAACTACGTGTCTTTTACCAAGGGAATAATATC---ACCGTGTCTGCATACGCCAATGGTGATCATGCAGTTACGGTGGAAGACGCGAAGTTTGTCATCGGTCCACTATCGTCCGCCTGGTCACCATTTGATAATAAGATCGTGGTGTACAAAGGCGAAGTCTACAATATGGACTATCCACCTTTCGGCGCAGGGAGGCCAGGACAGTTCGGTGACATCCAGAGCCGCACGCCAGACAGCAAGGACGTCTATGCGAATACGCAGTTAATACTGCAAAGACCAGCGGCAGGAGCAATACACGTGCCTTACTCCCAGGCACCTTCGGGCTTTAAGTACTGGCTCAAGGAAAAAGGGGCATCATTGCAGCATACTGCACCATTTGGCTGTCAGATAGCAACAAACCCGGTAAGAGCAGTGAACTGTGCAGTGGGCAACATACCAGTCTCCATTGACATCCCAGATGCAGCTTTCACCAGGGTCACTGACGCTCCTTCCATCACAGACATGTCCTGCGAAGTAGCTTCGTGTACCCATTCATCTGATTTTGGAGGTGCCGCAGTCATAAAGTACACAGCTAGTAAAAAAGGAAAATGCGCCGTGCACTCTGTAACAAATGCGGTCACTATCCGCGAACCTAACGTAGATGTCAAGGGAACAGCACAATTGCAAATTGCCTTCTCGACCGCACTAGCTAGTGCGGAATTCAAGGTGCAGATCTGCTCCACACTGGTACACTGCTCAGCGACGTGCCATCCTCCTAAAGACCATATAGTCAATTACCCGTCACCTCACACCACACTAGGAGTGCAGGACATTTCAACGACAGCTATGTCTTGGGTCCAGAAGATTACAGGAGGAGTGGGACTCGTGGTTGCTATAGCTGCTTTGATCTTAATTATAGTTCTCTGCGTATCATTTAGCAGA
Q86925_9VIRU/748-1243 CAACGGACTTCAGCGGATGAATTTACCGATACCATGGGGTACCTATGGCAACACAGTCAAACAATGTTCTGGATACAATTGGTCATACCTTTAGCAGCAGTGATAACT---------TTGGTTAGATGTTGCTCCTGCTGTCTACCT---------TTTTTATTGGTTGCCAGTCCT---CCTAACAAAGCGGACGCCTACGAACATACGATCACTGTCCCAAATGCGCCGTTGAACTCGTATAAAGCACTAGTGGAACGGCCTGGGTATGCCCCCTTGAATCTTGAAGTCATGGTCATGAACACCCAGATCATACCATCGGTTAAACGTGAATACATTACCTGCAGGTACCACACCGTTGTTCCTTCACCGCAGATTAAATGTTGCGGAACTGTCGAATGCCCGAAAGGTGAAAAAGCAGACTATACCTGCAAGGTGTTCACTGGTGTGTACCCATTTCTGTGGGGAGGAGCACAGTGTTTTTGCGACTCCGAAAACAGTCAGCTTAGCGACAAGTACGTCGAACTGTCAACAGATTGCGCCACAGACCATGCCGAGGCGGTCAGAGTACACACGGCTTCGGTGAAATCACAGCTCCGAATAACCTACGGGAACTCCACAGCA---CAAGTAGACGTATTTGTCAACGGTGTGACTCCAGCCAGGAGCAAAGACATGAAATTGATAGCCGGCCCATTATCTACTACATTTTCCCCGTTTGATAATAAGGTCATTATATATCATGGGAAAGTCTATAACTATGACTTCCCGGAATTTGGGGCCGGAACACCTGGAGCTTTCGGAGATGTCCAAGCGTCATCCACCACCGGATCAGATCTATTAGCAAACACAGCAATTCATTTGCAGAGGCCGGAAGCCAGAAACATACACGTCCCGTACACCCAAGCTCCAAGCGGGTTCGAATTCTGGAAGAATAACAGCGGTCAGCCTTTATCTGACACTGCCCCTTTCGGATGCAAAGTCAATGTCAACCCGCTACGTGCAGACAAGTGTGCCGTGGGATCACTCCCGATATCCGTGGATATACCGGACGCTGCATTTACACGCGTATCC---GAGCCCCTGCCATCACTGCTTAAGTGCACCGTTACTAGTTGCACATACTCTACAGACTATGGCGGAGTGCTCGTGTTGACATACGAGTCGGATCGCGCGGGGCAATGCGCTGTACACTCGCATTCATCAACAGCGGTACTGCGAGACCCATCGGTATACGTCGAGCAAAAAGGGGAGACTACACTTAAATTTAGTACGCGTTCCTTGCAGGCAGACTTCGAGGTATCGATGTGCGGAACGAGAACCACTTGCCATGCCCAATGTCAACCACCAACGGAACACGTAATGAACAGACCCCAGAAGTCGACTCCAGACTTCTCCTCAGCGATATCCAAAACATCATGGAACTGGATTACAGCGCTTATGGGGGGAATTTCCAGTATAGCTGCTATAGCCGCAATTGTGCTGGTCATAGCATTAGTATTTACAGCACAACAC
POLS_WEEV/738-1235 CGGCCAACCAACGCTGAAACATTTGGAGAAACTTTGAACCATCTGTGGTTTAACAACCAACCGTTTCTCTGGGCACAGTTGTGCATCCCTCTGGCAGCGCTTGTTATT---------CTGTTCCGCTGCTTTTCATGCTGCATGCCT---------TTTTTATTGGTTGCAGGCGTCTGCCTGGGGAAGGTAGACGCCTTCGAACATGCGACCACTGTGCCAAATGTTCCGGGGATCCCGTATAAGGCGTTGGTCGAACGTGCAGGTTACGCGCCACTTAATCTGGAGATCACTGTCGTCTCATCGGAATTAACACCCTCAACTAACAAGGAGTACGTGACCTGCAGATTCCACACAGTCATTCCTTCACCACAAGTTAAATGCTGCGGGTCCCTCGAGTGTAAGGCATCCTCAAAAGCGGATTACACATGCCGCGTTTTTGGCGGTGTGTACCCTTTCATGTGGGGAGGCGCACAGTGCTTCTGTGACAGTGAGAACACACAACTGAGTGAGGCATACGTCGAGTTCGCTCCAGACTGCACTATTGATCATGCAGTCGCACTAAAAGTTCACACAGCTGCTCTGAAAGTCGGCCTGCGTATAGTATACGGCAATACCACCGCG---CACCTGGATACGTTCGTCAATGGCGTCACGCCAGGTTCCTCACGGGACCTGAAGGTCATAGCAGGGCCGATATCAGCCGCTTTTTCACCCTTTGACCATAAGGTCGTCATCAGAAAGGGGCTTGTTTACAACTACGACTTCCCTGAATATGGAGCTATGAAACCAGGAGCGTTCGGCGATATTCAAGCATCCTCGCTTGATGCCACAGACATAGTAGCCCGCACTGACATACGGCTGCTGAAGCCTTCTGTCAAGAACATCCACGTCCCCTACACCCAAGCAGTATCAGGGTATGAAATGTGGAAGAACAACTCAGGACGACCCCTGCAAGAAACAGCACCATTTGGATGTAAAATTGAAGTGGAGCCTCTGCGAGCGTCTAACTGTGCTTACGGGCACATCCCTATCTCGATTGACATCCCTGACGCAGCTTTTGTGAGATCATCAGAATCACCAACAATTTTAGAAGTTAGCTGCACAGTAGCAGACTGCATTTATTCTGCAGACTTTGGTGGTTCGCTAACATTACAGTACAAAGCTGACAGGGAGGGACATTGTCCAGTTCACTCCCACTCCACAACAGCTGTTTTGAAGGAAGCGACCACACATGTGACTGCCGTAGGCAGCATAACACTACATTTTAGCACATCGAGCCCACAAGCAAATTTTATAGTTTCGCTATGCGGCAAGAAGACCACCTGCAATGCTGAATGTAAACCACCGGCCGACCACATAATTGGAGAACCACATAAAGTCGACCAAGAATTCCAGGCGGCAGTTTCCAAAACATCTTGGAATTGGCTGCTTGCACTGTTTGGGGGAGCATCATCCCTCATTGTTGTAGGACTTATAGTGTTGGTCTGCAGCTCTATGCTTATAAACACACGT
POLS_SINDO/747-1244 AGGTCGGCTAACGCTGAAACGTTCACCGAGACCATGAGTTATTTCTGGTCGAACAGCCAGCCGTTCTTCTGGGTCCAGCTGTGCATACCCTTGGCCGCTGTCATCGTC---------CTAATGCGCTGTTGCTCCTGCTGCCTGCCT---------TTTTTAGTGGTTGCCGGCGCCTACCTGGCGAAGGTAGACGCCTACGAACATGCGACCACTGTTCCAAATGTGCCACAGATACCGTATAAGGCACTTGTTGAAAGGGCAGGGTACGCCCCGCTCAATCTGGAGATTACTGTCATGTCCTCGGAGGTTTTACCTTCCACCAACCAAGAGTACATCACTTGTAAATTCACTACCGTGGTCCCCTCCCCTAAAGTCAAATGCTGCGGCTCCTTGGAATGTCAGCCCGCCGCTCACGCAGACTATACCTGCAAGGTCTTTGGAGGGGTGTACCCCTTCATGTGGGGAGGAGCACAATGTTTTTGCGACAGTGAGAACAGCCAGATGAGTGAGGCGTACGTCGAATTGTCAGCAGATTGCGCGACTGACCACGCGCAGGCGATTAAGGTACATACTGCCGCGATGAAAGTAGGACTGCGTATAGTGTACGGGAACACTACCAGT---TTCCTAGATGTGTACGTGAACGGAGTTACACCAGGAACGTCTAAAGACCTGAAAGTCATAGCTGGACCGATTTCAGCATCGTTTACACCATTCGATCACAAGGTCGTTATCCATCGCGGCCTGGTGTACAACTATGACTTCCCGGAATACGGAGCGATGAAACCAGGAGTGTTTGGAGACATTCAAGCTACCTCCTTGACTAGCAAAGACCTCATCGCCAGCACAGACATTAGGCTACTTAAGCCTTCCGCCAAGAACGTGCATGTCCCGTACACGCAGGCCGCATCAGGATTCGAGATGTGGAAAAACAACTCAGGCCGCCCACTGCAGGAAACCGCCCCTTTCGGGTGTAAGATCGCAGTCAATCCGCTTCGAGCGGTGGACTGCTCATACGGGAACATTCCCATTTCTATTGACATCCCGAACGCTGCCTTTATCAGGACATCAGATGCACCACTGGTCTCAACAGTCAAATGTGATGTCAGTGAGTGCACTTATTCAGCAGACTTCGGCGGGATGGCCACCCTGCAGTATGTATCCGACCGCGAAGGACAATGCCCTGTACATTCGCATTCAAGCACAGCAACCCTCCAAGAGTCGACAGTTCATGTCCTGGAGAAAGGAGCGGTGACAGTACACTTCAGCACCGCGAGTCCACAGGCGAACTTCATTGTATCGCTGTGCGGTAAGAAGACAACATGCAATGCAGAATGTAAACCACCAGCTGACCATATCGTGAGCACCCCGCACAAAAATGACCAAGAATTCCAAGCCGCCATCTCAAAAACATCATGGAGTTGGCTGTTTGCCCTTTTCGGCGGCGCCTCGTCGCTATTAATTATAGGACTTACGATTTTTGCTTGCAGCATGATGCTGACTAGCACACGA