EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00612 alignment
(335 sequences with 63 bp)


Q9ZVN3_ARATH/878-898 ACAAAGGCTGCTACAACTATTCAGGCTCAGTTCCGTTGTCACAGAGCAACTTTGTACTTCAAG
O24516_HELAN/832-852 ACTAAAGCTGCAATTTTTATACAGGCTCACTACCGTTGTCACAAAGCTTGTTCTTACTACAAG
Q9XEI4_MAIZE/831-851 ACAAAAGCTGCTGTCCACATCCAAGCTCAATGGCGCCGCCACAGAGACTACTCACATTACAAG
Q9SKB0_ARATH/765-785 ACAAAGGCAGCAATTATAATTCAGAGGGAATGGAGAAGACACCAAGTTCATGAAGCTTATAAG
Q9XFK9_MAIZE/670-690 ACAAGAGCTGCAATCATCATCCAGAGTCGCTGCCGTCAATTCTTGGCGAGATTGCATTATTCA
O64491_ARATH/845-865 ACTAAAGCTGCAACCATAATCCAGACCCGGTGTCGCGTATACTTGGCTCGGCTGCATTACCGA
Q9SVT9_ARATH/832-852 GACAAGGCGGCAATTATGATTCAGAGTCATTGTCGCAAATTCCTGGCCCAGTTGCACTACCAG
O24517_HELAN/831-851 ACAAAAGCTGCAATCCTTATTCAGAGCCATTGCCGGAAGTTCTTGGCCCGCTTGCACTTTATC
Q9SK73_ARATH/837-857 ACCAAGGCCACAACTGTGATTCAGAGCCATTGCCGTAGACTCCGGGCCGAGTTGCACTACAAG
Q9VSS9_DROME/28-48 GAACAGGCGGCCATCCTGCTGCAGTCCACGCTCAAGGGATATGCGGCGCGTAGGAAGTACCAG
O81486_CHLRE/785-805 GAGAAGGCCGCGCTCACCATCCAGCGGCTGTGGCGCGGCTACACGGCGCGCACCACCTATCTG
O04145_ACECL/877-897 GAACGAGCTGCACTGACAATCCAGAGTTGTTACAAGGGATATGTAGCACGCTAAAAATATAGA
Q9SNF0_ARATH/889-909 CATAAGGCTGCTGCTACTATACAGAGCCAAGTTAAAAGCAAGATTGCTAGGATACAGTATAAG
MYOE_DICDI/717-737 AGAAAAGCTGCCATTAAAATCCAGTTATTCTATCGTAGCTATCGTTATAACAAATGGTTCAGA
PPE1_MOUSE/33-53 ATAAAAGCCGCGTTAGTCATCCAAAATTGGTACCGGCGGTACAGAGCTCGACTGAGGGTCAGA
PPE1_HUMAN/17-37 CTGAGAGCTGCGTTGATCATCCAGAACTGGTACCGAGGTTACAAAGCTCGACTGAAGGCCAGA
PPE2_HUMAN/20-40 TTCAAGGCAGCAGCCCTGATCCAGAGATGGTACCGGCGCTACGTGGCCCGCCTGGAGATGAGG
O01921_CAEEL/83-103 ATCAAATCGGCAATTCTCATTCAAAAATGGTATCGCCGGTGTGAAGCAAGGTTAGAAGCTAGA
Q9VHB4_DROME/188-208 CTTTTGGCTGCCATGAAGATTCAGAAGATGTGGCGTGGCCACACAGCCCGACGGATAACGCGG
MYO10_BOVIN/789-809 AAAAAAGCAGCTGTGGTTTTCCAGAAGCAACTCCGAGGTCAGATTGCCAGAAGAGTTTACAGA
O17666_CAEEL/960-980 AAGAAGGCAGCTGTTGTCATTCAGAAAATGATACGTGGTTTCATTGCACGGCGTAAATTCCAA
O49705_ARATH/693-713 GAAATTGCAGCAGTGATCATACAATCGAATATTAGGGGACTTCATGCACGCCGCAAGTTTAGA
MYO5B_RAT/815-835 ACCCGGGCGGCCATAGTGTTCCAGAAGCAGTACCGCATGCTGAAGGCCCGCCGAGCCTACTGC
RDGC_DROME/6-26 ATCCGAGCGGCAATCTTCATCCAGAAATGGTATCGCAGGCACCAGGCCCGTCGCGAAATGCAG
O81486_CHLRE/833-853 GTGCGCGCCGCCATCACCATCCAGAAGCGCTGGCGCGGCTTCCAGGCGCGCCGCGACTACCAG
Q9SSU1_CHACB/743-763 AATGAGGCTGCAGTCAAGATCCAGCACATGGTTCAGAGTTTCCTGATGCGTAGAGACTATGAG
Q17383_CAEEL/808-828 GCAGCTGCTGCAACTGTGATTCAGAAGATGTGGAAAGGATTTTTGGCCAGGAGAAAATACGAA
ASPM_MOUSE/2562-2582 CATGGGGCCGCTATGATTACACAGAAGCATTTTAGAGCCTTTAAAGCAAGGAGGCTGATGGAG
Q9ZU28_ARATH/100-120 CGGTGGGCTGCGGTCAAAATACAAAAAGTCTTCAGGGGCTCTTTGGCGAGGAAAGCATTAAGA
Q9SZE3_ARATH/115-135 CATCGTGCTGCTATGCAGATCCAATGTGCCTTTAGAGGCTACTTGGCGAGAAAAGCGTTGAGA
Q9SG11_ARATH/110-130 CACGTGGCTGCTATTCTCATTCAGACAGCTTTCCGAGGATGCCTGGCAAGAACAGCGGTTAGG
O64852_ARATH/84-104 GAATGGGCTGCTATTAGAATCCAAACCGCTTTTCGTGGATTCTTGGCGAGAAGAGCGTTGAGG
O82755_ARATH/167-187 GAACTTGCGGTGATTAAGATACAATCTATATTTCGCGGATACTTGGCAAAGAGAGCGTTAAGG
Q9SSU1_CHACB/814-834 CGGCAAGCTGCTATCAGGATTCAGTCTGCCATCAGGTCTCTTGCTGCACGGAGGGTTCTTTGC
MYO5B_RAT/886-906 CGGGATGCAGCCATTGTCATCCAGTGTGCCTTCCGGAGGCTCAAGGCCAGGCAGGCACTGAAG
O81486_CHLRE/856-876 CGCAAGGCGGCCATCGCCATCCAGAGCGCGCACCGCGTCAAGGTGGCGCGCAAGGCGCTGCGC
Q9XZE9_HYDAT/732-752 GAACCATCAGCAGTAAAAATTCAAGCTGCATTTCGTGGATACAAAGCTAAGAAAGAATATAGA
Q39954_HELAN/105-125 GAAATCAGTGCCACCAAGATTCAGGCGGCTTATCGTGGGTACACGGCAAGAAGGGCTTTCCGG
O22835_ARATH/311-331 CATGCTTCTGCAACAAAGATTCAAGGAGCTTTCAGAGGTTACATGGCAAGGAAGAGTTTCAGA
Q17383_CAEEL/904-924 GAGAAATCTGCAATCACAATTCAAGCAGCTTGGCGTGGATATTTGGCGAGACGTGAGCAAATC
O88849_MOUSE/556-576 GACATCGCTGCCTTCAAAATCCAAGCAGTCTACAAAGGATACAAGGTCAGAAAAGCCTTCCGA
Q9W1U2_DROME/117-137 CATCGGGCGGCCACCAAGATCCAGGCCCTATTCCGAGGATGGAAGAGCCGGCGCACCATTCAC
Q9VJM7_DROME/105-125 CACGATATGGCCACTAAGATTCAGGCGCTGTTCCGCGGATGGATGACTCGCCAGTACTTCCAG
ASPM_MOUSE/2675-2695 CATCGAGCTGCTTGTGTGATTCAAGCCCACTTTAGGGGCTATCAGGCAAGGCAGTCCTTCCTG
ASP_DROME/1005-1025 CACCGGGCCGCTACTGTCATTCAGGCCGTGTTCCGTGGCCACCAGATGAGAAAGTACGTGAAG
Q9VGW5_DROME/112-132 ACCGATGCCGCTGTTAAAATTCAGGCTGGCTTCCGGGGATTCAAAACACGCAAAGAATTGAAA
SP17_MONDO/144-164 CAAGATGCTGCTGTCAAAATCCAGGCAGTATTCCGGGGTCATAAGACAAGAAAGGAATATCTG
Q9V791_DROME/168-185 TGCCATGCTGCATTGAAGATTCAGTCCACTTTCCGTGGTCATTTGGCACGCAAG---------
Q9SF32_ARATH/108-128 GAAGCAGCTGCCATCTTAATCCAGTCTACGTTTAGGGGCCATTTGGCAAGAAGAGAATCGCAG
Q9TU08_SHEEP/111-131 GAAAATGCTGCTCTCAAAATCCAGGCAGCCTTCCGGGGACACTTGGCCAGAGAGGAGGTAAAG
SP17_MACEU/123-143 GCTGCTGCTGCTGTCAAAATCCAGGCAGCATTTCGGGGACATAAAGCAAGAAAGGAAGTGAAG
Q9SD11_ARATH/37-57 GAGATTGCCGCCGTTAAAATCCAAGCCTTTTTCAGAGGGCACCTGGCAAGAAGAGCGTTTAAA
Q9VGW5_DROME/18-38 GAGAGTGCGGCCATTAAGATTCAGGCCGGATTTCGTGGCTACCGTGTGCGCAAAGAGATCCAT
Q9UPX7_HUMAN/514-534 GATGAGGCGGCTGTGGTGCTTCAGGCAGCTTTCAGGGGACATCTCACGCGGACAAAGCTCTTA
Q9VGW5_DROME/89-109 GATCGTAGTGCCACCAAGATACAGGCGGGATTCCGGGGATTCCTGGTGCGAAAGAAGCAGAAA
Q9VGW4_DROME/2631-2651 GTTTCGGCGGCCACGAAGATCCAGGCCGGAGCTCGTGGCTTCCTTACCAGGCGAAGATTGCGG
Q9SWV4_LYCES/385-405 CACGCTGCTGCTGTCCGTATACAAAATAAACTTCGCAGTTGGAAGGGAAGAAGAGATTTTCTT
Q9SID7_ARATH/863-883 CAAGCCGCTGCTATTCGGATTCAGAACAAGTTCCGAGGTTACAAGGGAAGAAAAGACTATTTG
O88849_MOUSE/915-935 AACAAGGCAGCGGCGGTCATCCAGCGAGCTTGGCGAAGCTACCAGCTCAGGAAGCACCTGTCT
O65373_ARATH/51-71 ACCGCCGCAGCAGCGAGGATTCAGTCTGGCTACCGTTCTTATAGGATCCGAAACCTATACAAG
O04146_ACECL/929-949 GTTATTGCCGCAGCAATCATCCAAAAATGGTTCCGCGGGTACCAAATTCGAAAGGAAACCAAG
Q9XFK9_MAIZE/622-642 GAAGCTGCTTCACTCAAGATCCAGACTTTGTACCGTATGTATACTGCCAGAAAAGCGTACAAC
Q9SVT9_ARATH/784-804 GATGCAGCTGTTTTGGAGATTCAGAGAGACATACGAATGCATCTTGCTCGGAAGTCTTACAAG
Q9SK73_ARATH/793-813 GAAGCTGCTGCTTTGAAGATCCAGAGAGCTTTGCGGATCCACCTTGATAGGAAGAGGTCTTAC
O64491_ARATH/797-817 GAAGCTGCTGCTTTGAAAATCCAGAGAGACTTGCGTAAGTTTCTGGCCAGGAAAGCTTACACT
Q9SKB0_ARATH/717-737 GAAGCTGCTTCAATTTGTATCCAAAAGAACATTCGTGCTCACAGAGCAAGGAAAAACTATACT
O24517_HELAN/783-803 GAAGCTTCTAGTATACGGATTCAAAGGAATTTACGAATGCATATTGCAAGGAAAGGTTACAAA
Q9XEI4_MAIZE/783-803 GAAGCAGCAGCAGTGAAAATACAAAAGAATATGCGACGCCACAAAGCACGGGAATCTTATTTA
O24516_HELAN/784-804 GAAGCAGCAGCAGTCAAGATTCAAAAAGATTTCCGTTGTTTTGTTGCTAGCAAATCGTATCAA
Q39159_ARATH/502-522 GAGGAAGCTGCCATCAAAATCCAGAAAAACTTACGTAGACAGATTGCAAAGAAAGATTACGGG
O04146_ACECL/951-971 ATTTTCGCAGCCCGAAAAATCCAAAAATCAATCCGTGCGTATCTCTTGCGTTCTGGCTATTAC
Q9SMY9_ARATH/777-797 GCGGCGGCAGCTGTCTTGGTCCAAAAGCATGTGCGCAGGTGGCTGTCAAGATGTGCATTTGTA
Q39160_ARATH/781-801 GAAGCTGCAGCTCTAAGAGTCCAGAAGAATTTCCGCCGGTACGTTGACAGGAAATCTTTTGTC
Q9Z1N3_RAT/1117-1137 CACAGGGCTGCTACCTGTATACAGTCAAGATGGAGGGGCTACAGGCAAAGTAAGAAGTACAAA
IQGA1_HUMAN/776-796 ATCCCTGCCATCACCTGCATTCAGTCACAGTGGAGAGGATACAAGCAGAAGAAGGCATATCAA
Q9UNJ2_HUMAN/1116-1136 CACATGGCTGCTATTTGCATACAAGCAAGATGGAAAGCCTACAGGGAAAGTAAAAGGTACCAA
Q9U1M8_DICDI/692-712 CTCAAAAAAGTTACACTCATTCAATCAGTTTGGAGAATGTATCGTTGTAAGAAACGTTATCAA
Q9XZE9_HYDAT/762-782 CTTCCTGCAATTGTTAAAATTCAGGCCACATGGAAATCCTACCAAGCTAAAAAGGCATACCAA
Q9SSU1_CHACB/839-859 AACCATGCTGCCACTCAGATTCAGTCAAAGTGGCGCAGCTATGTCGCATTCAGGAGCTACGAT
Q9V3Z6_DROME/760-780 AGAGCTGCTGCTATCACTGTGCAGCGATTCTGGAAGGGCTATGCTCAACGTAAACGATACAGG
P91443_CAEEL/759-779 AGACAAGCTGCTGTCACCATTCAAACTGCATGGAGAGGTTTTGACCAAAGGAAAAGATATCGT
MYO9B_RAT/1003-1023 ACGCGGGCAGCTGTGTATCTTCAGGCTGCCTGGAGAGGCTACCTGCAGAGACAGGCCTACCAC
Q9U487_LOLPE/804-824 AAATTTGCTGCTATTCGCATCCAAGCTTATTTCCGTGGTTACCTATGCCGCAAAATCTACCAG
Q23673_CAEEL/297-317 ACGCAAGCGGCAATTAGGATTCAGGCGAGAACCCGTGGATACTTTGCTCGAAAGTTGGTTCGA
Q9UNJ2_HUMAN/1075-1095 GCTAGTGCAGCTGCTCTTCTCCAAGCTTCCTGGCGTGCTCACTTAGAGAGGCAGCGGTACTTG
Q9SMY9_ARATH/825-845 CATCGAGCTGCTTCTCTAATTCAGGCTCATTGGAGAATCCATAAGTTTCGCTCAGCATTCAGG
MYO7A_MOUSE/768-788 AAGAGTGCTGCCACACTGATCCAGAGGCATTGGCGGGGCCACCACTGTAGGAAAAACTATGAG
MYO51_SCHPO/801-821 GAACGAGCAGCCATTCTTATTCAAGCTCATTGGCGATCTTATATCCAACGCAAAAGATATTTG
MYO5A_MOUSE/815-835 ACCAAGGCAGCAACCACCATTCAAAAGTACTGGCGCATGTATGTGGTCCGCAGGAGGTACAAG
MYO5A_CHICK/816-836 ACACGGGCTGCCATCATTATTCAGAAGTTCCAGCGTATGTATGTGGTCCGCAAAAGATACCAG
Q39159_ARATH/550-570 ACTAGGGCAGCAACTGTGATTCAGGCGTATTGGCGTGGTTACAGTGCTATATCTGACTACAAG
MYO10_BOVIN/743-763 ACGCGGGCGGCCATGGTGATCCGGGCCCACGTCTTGGGCTACTTGGCAAGAAAGCAATACAAG
MYOJ_DICDI/825-845 GATCGTAGTGCAACAGTTATTCAAAAGAGATGGAAAGGTTATTTATATCGTAAACGTTATAAA
ASP_DROME/1691-1711 AAGCGCGCCGCCAAGGTTATACAGCGTTACTGGCGGGGCTATCTAATCCGACGACGTCAGAAG
Q9XEI4_MAIZE/735-755 GGAAGAGCAGCAAGAATCATACAGAGGCAAATACGTACATATATTGCAAGGAAACAGTTTGCT
O24516_HELAN/736-756 GGAAATGCAGCTAGAATCATTCAAAGGCAAATGCGTACTTATATTGCACGCAAGGAGTATATT
Q39160_ARATH/733-753 GGGAATGCTGCCAGAGTCATTCAGAGGCAATTCCGCACATGTATGGCTAGAAAGAATTACCGT
Q9SKB0_ARATH/669-689 GCTGGTGCCACTAAACTCATTCAGAGGCAGATCAGAACTTATCTGACAAGAAAAGAGTTCCTT
Q9SVT9_ARATH/736-756 GGCAGAGCAGCCAGCAGGATCCAGAGGAAATTCCGTTCCTACTTGTCCCGCAAAACTTTTCTT
Q9SK73_ARATH/745-765 GGAAGAGCAGCCTGCATTATCCAGTGGAAATTCCGCTCCTACCTGACCCGCCAAAGCTTTATA
Q20456_CAEEL/940-960 GGAGATGCTGCTATTATTATTCAAAAAAATATGAAATCGTTCGTTGCTCAAAAAGTGTACAAA
O24517_HELAN/735-755 GGTAGATCAGCTAGCATCATTCAAAGAAAAGTCCGTTCATTTATCGCTCAGAAGAGTTATATA
Q9UNJ2_HUMAN/1043-1063 AGACAAGCATCTGTTATTATCCAGAGATTCTGGAGGAATTACCTAAATCAGAAGCAAGTCAGA
ASP_DROME/1032-1052 ACTCAGGCCGCAATAATTCTGCAAAAGTTCACCCGTCGGTATTTGGCCCAGAAGCAGCTATAT
Q9XFK9_MAIZE/597-617 CGAAGATCAGCTTTACAAATCCAGACAGTTTGTCGCGGTGAACTTGCAAGAAGAGTTTATCAC
O24517_HELAN/758-778 AAGCGTTCTGCTTTGCAAATTCAATCTGTTTGCCGAGGTCAACTTACTCGCCGAATTTATGAA
O64491_ARATH/772-792 CGTATTTCTGCTACACAAATCCAAGCAGTTTGTAGAGGTTATCTTGCTAGAAGTATATACGAA
Q9XEI4_MAIZE/758-778 AAAAGATCAGCAACACAGCTGCAATCTTTTGTCAGAGGAACCTTGGCTCGTAAGTTGTATGAG
Q9SMY9_ARATH/752-772 CGGGCTTCTGCAATTTCAATTCAGGCATACTGTAGAGGATGCCTGTCTCGAAATGCTTATGCC
Q9SVT9_ARATH/759-779 CGCAAGGTTGCAACTAATATGCAGGCTGTGTGCAGAGGTCAACTTTCTCGGCTTATCTTTGAG
Q9SK73_ARATH/768-788 CGCAACGCTGCAATAAATATACAGGCTGTGTACAGAGGTCAAGTTGCTCGATATAGATTTGAG
Q17383_CAEEL/856-876 CATCGTGCTGTGATAGTCATGCAATCTGCTGTTCGTGGATATTTGGAGCGACGGAAGTATGAA
MYO4_YEAST/900-920 AAAAGGAGCTCCATTCTTGTACAAAGCGCCATGAGAATGCAGTTAGCTAGACGAAGGTATATA
Q9XFK8_MAIZE/821-841 CATAGAGCCGCAGTTGTTTTGCAGAGAAATGTGAGATGTTGGCTTGCAAGAAGGTATTTCATA
O88420_RAT/1894-1914 GAGGTGTCTGCAGTGGTCCTGCAGCGTGCCTACAGGGGACACTTGGCTAGGCGGGGCTTCATC
O97417_DROME/871-891 CACTACCGGGCAGTTCAGATCCAGCGTTTCGTGCGTGGTGCTTTGGCACGGCGAGCTTACCAA
O81486_CHLRE/737-757 AACGCCGCCGCCATCACCATCCAGCGCTTCGCCCGCGGCGCGCTCGCGCGGCGCCACTTCATC
MYO5B_RAT/790-810 AGAGCAGCTACGCTAACCCTGCAGAGATTCTGCCGAGGATACTTAGCCCGCAGACTGACTGAG
Q9VJM7_DROME/46-66 TTCAACGCTGCAAGGACTATTCAGTGTCATGTGAGGGGATTTTTGGCCAGAAGTACTCTTAAA
MYO5A_MOUSE/790-810 CAGAGGGCAGCCATCACAGTGCAGCGATACGTGCGGGGCTATCAGGCTCGATGCTATGCTAAG
Q9U487_LOLPE/827-847 AAATTGGCTGCAATTGTCGTACAGAGATATGCGAGAAAAGCGCTGGCCCAGAGACTTTTCCGC
MYO7A_MOUSE/837-857 CTCTGGGCCGTGATCACCGTGCAGGCCTATGCCCGAGGCATGATTGCCCGCCGGCTACACCGC
Q9SSU1_CHACB/766-786 AAGAGAGCATCTCTGTTGGTGCAGGCATACTGGAGAGGGACAATGGCAAGAATGGAGTTCAGA
MYO15_MOUSE/1887-1907 AACCGAGCTGCCCTCACCCTGCAGCGCTACCTGCGAGGTTTTTTCATCCAACGGCACTTCCGG
Q9XFK8_MAIZE/795-815 ACAAGAGGAGTTTTGACTCTTCAATCATTCATTCGTGGTGAGAATGCACGGCAAATTTACTCC
Q39157_ARATH/786-806 CGGAAAGTAACATTGGTTCTTCAGTCATATATACGAGGTGAAAATGCCCGAAGATTGTTTGAC
O81840_ARATH/848-868 AGGAATGCTGCAGTGATACTTCAGTCATATATCCGTGGAGAAAATGCCAGGAGAAACTACATT
Q39160_ARATH/756-776 CGCAATGCTGCAATTGTTTTGCAATCCTTCCTACGAGGCGAAATTGCCCGGGCAGTGCACAAG
Q20456_CAEEL/963-983 AGAGCAGCAATTATAAAATTGCAATCGGGACTGAGAGGATGGAAGGCAAGAAGAGATTACATC
Q9U487_LOLPE/852-872 GACCACAAAGCAACCGTCATCCAGACCAGAGTTCGGGCTTACTTGGCTCGCAGAAAATTCGAG
P91443_CAEEL/736-756 AAGGATAAGGCAATTGTTATTCAGAAAAATGTCAGGAGATGGTTAGTGAGAAAAGACTTTGAG
MYO5A_MOUSE/863-883 GAATACAAAGCAGTCATCATTCAGAAACGTGTCCGTGGCTGGCTGGCCCGTACACATTATAAG
MYO5A_CHICK/864-884 GAGCACAAGTCTATTATTATTCAGAAACATGTAAGAGGCTGGCTGGCTCGAGTGCACTATCAT
MYO5B_RAT/863-883 GAGCACAAAGCCACCATCATCCAGAAGTACGCCCGGGGCTGGATGGCACGGAGACATTTTCAG
MYOJ_DICDI/873-893 ACTCATTCAGCCATTTTAATACAAAAAGTTTGGAGAGCTCATAGGGATAGAGTTCAATATCAA
MYO1A_MOUSE/698-717 CAGCAGCTGGCCACCCTCATACAGAAGGTCTACCGCGGCTGGCGCTGTCGGACCCACTAC---
Q9PWF6_MORSA/814-834 ACCAGTGCCTGTATCAAGATGCAAAAAACAGTTCGGATGTGGCTCTGCAGGAAGAAGCACAAG
Q29122_PIG/815-835 GCTGAAGCCTGCATTAAAATGCAGAAAACTATTCGAATGTGGCTTTGCAAAAGGAGACACAAA
MYO5A_MOUSE/838-858 CGAGCTGCCACGATTGTTATTCAGTCTTACTTGAGAGGCTACTTGACAAGAAATAGGTATCGC
MYO5A_MOUSE/767-787 CGGGCTGCCTGCATCCGGATCCAGAAGACCATTCGTGGGTGGCTTCTAAGGAAGAGATACCTG
MYO5B_RAT/767-787 CGGGAGGCCACCATCATGATCCAAAAGACGGTCAGGGGCTGGCTGCAGAGAGTGAAGTACCGG
Q39157_ARATH/824-844 TTGAGTGCAGTCATACACTTGCAATCTGCGGTTCGTGGATGGTTGGCTCGCAAACATTTCAAT
O81840_ARATH/884-904 CTTGATGCAGCTATACACTTGCAATATATGGTACGCAAATGGCTGGCTCGTAAACTCTTAAAT
O49705_ARATH/716-736 ATGAGAGCAATCTGCTTCTTACAAGCTGCTGTTCGGACATGGTTATCAGTGAAAAATATACAA
Q9XFK9_MAIZE/645-665 TCTGCTTCAGCAGTTACCATTCAATCAGGATTGCGCGGCATGTGCGCGCGTAAAGAGCTCCAC
O24517_HELAN/806-826 CATTCCTCGGCTGTTTCAATCCAAACAGGTTTACGGGGAATGGCTGCACGTGATGAGCTTCGG
Q9SK73_ARATH/814-834 ATTGAAGCTGTTGTTACAGTTCAGTCAGGTTTGCGCGGTATGGCTGCTCGTGTCGTACTACGA
Q39159_ARATH/525-545 AAATCTTCCGCACTCACCTTGCAAAGTGGAGTCCGCACAATGGCTGCACGTCATGAATTCCGT
Q39158_ARATH/806-826 TATTCTGCTGCTGTTTCGGTTCAAGCTGGTATGCGTGGTATGGTTGCCCGGAAAGAACTATGT
O64491_ARATH/820-840 TTTTCTGCTACTATTTTAATTCAAGCGGGTATGCGTGGTATGGTTTCCCGAAAGGAATTGTGT
Q9XEI4_MAIZE/806-826 CAAGCAGCTGCAATCACATTGCAGACAGGTTTAAGGGCAATGTCTGCTCGCAAAGAATTCAGG
Q39160_ARATH/804-824 AGATCATCTACAATCGTGTTGCAGACTGGCTTAAGGGCCATGATTGCACGTAGTGAATTCAGG
O24516_HELAN/807-827 AGGGCATCTACAATTAATTTACAAACGGGATTACGAGCAATGACTGCTAGAGATGCGTTCAGA
Q9SKB0_ARATH/740-760 CAGGCATCAGCAACAGTTATTCAGACTGGTTTACGGACAATGTCTGCTCGAAACAAGCATAGA
Q9XEI4_MAIZE/854-874 CAAGGAGCAGCTCTTACTTACCAGTGTGCCTGGAGGCAAAGGCTTGCCAGAAGGGAGCTCAGG
Q9SK73_ARATH/860-880 AAAAAAGCAGCAATTACAACACAAAGTGCATGGAGAGCAAGGCTAGCCCGTAAAGAACTGCGA
Q39160_ARATH/852-872 CAGAAGGCGGCAATAGTCACACAATGTGCCTGGAGATGCAGACTTGCTAGAAGAGAGCTTAGA
Q9SKB0_ARATH/788-808 AAAAAAGCAACATTAGCATTACAATGTCTATGGAGAGCTAAAGTAGCTCGAAAAGAGCTAAAA
O24516_HELAN/855-875 CAAAAGGCTACGTTATATACTCAATGCTGTTGGAGACGTAGGGTTGCAAGAAAAGAGCTTCGG
O64491_ARATH/868-888 AAGAAAGCAGCCATCACGACACAATGTGCATGGAGAGGAAAAGTTGCGCGGAAAGAACTCAAA
O24517_HELAN/854-874 AAGAAGGGTGCGGTTTCTATACAATGTGCATGGAGGGGAAAAGTTGCTCGTAAAGAGCTACGG
Q9SKB0_ARATH/692-712 AAAAGGGCTACAATTTATATGCAAAAACTTTGGAGAGCAAAACTTGCTCGCAAGTTGTATCAA
Q39160_ARATH/829-849 AGAAAAGCCGCCATTGTACTTCAGGCTCATTGGCGTGGTCGCCAAGCATTCTCATATTACACA
O24516_HELAN/759-779 CGCAAAGCTGCTATTCAGTTGCAGGCTTGCTGGCGAGCTTTATCTGCCTGCAAGCAATTTCAA
Q9W1U2_DROME/81-101 AGAAAGGCGGTCATCACGATTCAGCGCTGGTGGCGCGGATTCTCGGTCCGAAAAAACCACTTC
MYS9_DROME/812-832 AACAAGTGTGTTCTAATAGCCCAGCGTATTGCACGTGGTTTCCTGGCCCGGAAGCAGCATCGC
MYO1A_RAT/736-756 CGGTCATCAGTACTGCTGATCCAGGCTTTCGTGAGGGGCTGGAAGGCCCGCAAGAACTATCGA
MYO1A_MOUSE/744-764 CGGTCGTCAGTGCTGCTGATCCAGGCTTTCGTGAGGGGCTGGAGGGCCCGCAAGAACTATCGA
O81486_CHLRE/760-780 CGCTCCGCGGTGCTCACCATCCAGTGCGCCATGCGCGCCTGGGCCGCGCGCAAGCTCACGTCG
ASPM_MOUSE/2698-2718 AGATCTGCTGTTTTAATCATACAGAGACATGTACGAGCCATGGTGGCTGCGAAGCAGGAAAGG
Q39159_ARATH/477-497 CGGAGGGCTTCAGTTAATATACAAGCTAATTGGAGAGGAAATATTGCACGAAAGATATCTAAG
Q9VQV7_DROME/604-624 GAGTCCTCGGCCGTTACCATCCAAAAGATGTGGCGAGGCTATCACACACGCAAGAAGACCAAC
Q25150_HALRO/1969-1989 GAAATGTCTGCTGTTATCATTCAAAGATCTTGGAGACGCTATCGCATTCGTCACGCGGTTCAT
MYO51_SCHPO/849-869 GAAAGTTCTGCTACACTTCTTGCAAAATTTTGGCGAGCGTACAACGCAAGAAAAACTTTTAGA
Q9VLK6_DROME/1028-1048 CACAAGAGCGCCACCCTGATGCAGGCCACCTGGCGAGGCTGGTGGTGGCGCAAGAAGATGGGC
Q92002_RANCA/700-720 CACAGCATAGCAACATTCCTCCAGGCTAGGTGGAGAGGATATCATCAACGACAGAAATTCCTG
MYO1C_HUMAN/700-720 CAGAGCCTGGCCACAAAGATCCAAGCTGCCTGGAGGGGCTTTCACTGGCGGCAGAAATTCCTC
Q9VGC1_DROME/191-211 AACCAGGCAGCCATCACGATCCAGGCGGCTTGGCGAGGATACTGGGTTCGCCTCCAGTTCCCG
O04146_ACECL/815-835 AATAAATTCGCTCGGAAAATTTAAGCTGCTTGGCGCGGTAAATATGTTCGTGATTAGTTTGTT
Q9VJM7_DROME/69-89 ATCGATGCTGCCACCATCATTAGCAAGTGGTGGCGTGGTTTCTGGGTGCGACACTCAAAGTTC
MYOA_DICDI/723-743 AATGATTTAGCCACTAAAATTGGATCAGTTTGGAAAATGTATAAACAAAGAAAATGGTATTTA
O17666_CAEEL/558-578 AATGAGAAAGCGACCAAGATTCAACGAATGTGGAAGGCCTACGTGCAAAGAAAGAATACTCCC
MY61F_DROME/707-727 CATGAGATAGCGGCCATCATCCAGGCCCACTGGAAGGGATTGATGCAGAGGAGGAAGTATCTG
IQGA2_HUMAN/690-710 GAAGAGAATGTGGTCAAAATACAGGCTTTTTGGAAAGGATATAAACAACGGAAGGAGTATATG
O04145_ACECL/829-849 AATATCAGCGCTACTAGGATTCAAGCTTGTTGTAAGAGACATCAGGCTGTGAAGCGTTATTAA
ASPM_MOUSE/2603-2623 GTGGAAGCTGCCTGCAGGATTCAAGCTTGGTATAGGCGTTGGAGAGCGCACAAGAAATATCTA
MYO5B_RAT/838-858 CGCAGGGCTGCGGTCATCATCCAGTCCTACACGAGGGGCCATGTGTGTACGCAGAAGCTACCG
MYO4_YEAST/877-897 CTCATGGCGGCAGTAATTATCCAAAGCTACATCAGATCATATGGTCACAAAACAGATTACAGA
O24515_HELAN/846-866 CACAGGGCGGCTGTGCATATACAAAAACATATTAAAGCCAAAATAAGCAAGAAAAGATTTGAA
Q9XZE9_HYDAT/822-842 ATAAAAGAAGTGGTACAAATTCAATCTTTTCTCCGTGCTAATTTAGCACACCATGATTACAAA
IQGA1_HUMAN/836-856 ATAAATGACATTATCAAAATCCAGGCTTTTATTCGGGCAAACAAAGCTCGGGATGACTACAAG
IQGA2_HUMAN/750-770 AATAATGAAATTGTGAAAATACAGTCACTGTTGAGAGCGAACAAAGCTAGAGATGACTACAAA
Q9UPX7_HUMAN/573-593 GAGGAGGCCATCGTCATCATCCAGTCCGCTCTGCGGGCACACCTGGCCCGGGCCAGGCACAGT
GNRP_MOUSE/207-227 ATCAAGAAAATTAAGAAGGTTCAGAGCTTCCTTCGGGGATGGCTGTGCCGGCGAAAGTGGAAG
Q9V3Z6_DROME/829-849 ATGTGGGCCGTCATTAAGATCCAGTCTCATGTGCGGCGTATGATTGCCATGCGGCGCTACCGA
MYO51_SCHPO/824-844 ATCAAATGTGCTATTGTTATTCAATCAATAGTTCGGAAGAATATCGCATATTCTCGTTATATA
Q9XZE9_HYDAT/792-812 GAAGATGCTGTTATTAAGATTCAAGCAACTGCAAGAATGTTTTTAGCAAAAAAAAAGTATAAT
IQGA1_HUMAN/806-826 AAAGATGAAGTTGTAAAGATTCAGTCCCTGGCAAGGATGCACCAAGCTCGAAAGCGCTATCGA
IQGA2_HUMAN/720-740 ACTGATTCTGTTGTGAAGATTCAGTCCTGGTTCCGAATGGCAACTGCAAGAAAGAGCTATCTT
Q9TW28_DICDI/890-910 GTTGATTCAGTTTTAAAGATTCAAGCATTCTTTAAAATGATTAAAATTAGAAATCAATATAAA
IQG1_YEAST/718-738 GTAAGGTCGGTTATTATGATTCAAAGCTGGATTAGGAAAAGTCTGCAAAGATCGGCATATTTG
ASPM_MOUSE/2786-2806 ATGGATTCAGTCATCTTCATTCAGAGATGGTTTCGAAAAAGATTACAACGAAAGAGGTTCATT
MYO10_BOVIN/766-786 CTTGATTGTGTAGTGATCATACAGAAGAACTACAGGGCCTTCCTCCTGAGGAGGAGATTTTTG
MYSN_ACACA/791-811 TCCAAGATGGTGGTGTCGATCCAGGCCGGCGCGCGCGCCTTCCTCGCCCGCCGCATGTACGAC
MYO3_CAEEL/795-815 TCTAGAATCGTTACCATGTTCCAATCCCGCATTCGTTCTTACCTTGCCAAGGCCGAAGTTCGT
RNG2_SCHPO/390-410 GTAAACTGGGTTACTTCTATTCAATCCATCTCTCGTGCATATCTGATACGTGCACAATACCGT
MYO52_SCHPO/866-886 CATGATGCAACATTAATTATTCAAAGTCTTTGGTTAACATTTAAAGCCCATAAGCACTACAAA
O04146_ACECL/863-883 GAACCTGCAGCCCTCATTATTCAAAACGTTTGGAAAGCTCACAAAGTTCGAAAATTCGTCAAG
Q9VLZ3_DROME/764-784 CGCGAGGCCATTATTACGGTTCAGAGATATTGGCGAGGTCGCCTGCAGCGTCGTAAGTACCAG
ASP_DROME/1468-1488 AGGGAAGCCATTATCAAAGTGCAACGACGATACCGCGGCAATCTGGAGATGAGGAAGCAGATT
ASP_DROME/1279-1299 CGCAAATGTATCATCAATGTCCAGAGGCGCTGGAGAGCCACTCTGCAGATGCGTCGAGAAAGG
ASP_DROME/1082-1102 CGAGAGGCTGCGATCTTTCTTCAGCGGATCTGGCGGCGACGACTCTTTGCCAAAAAACTATTG
MYOA_DICDI/745-765 ACTTTAGCTGCAATTAAAATTCAAAGGACCTATAGAGGTTGGTTACTCGTTAGAGAATGTGTT
MYO1C_HUMAN/723-743 AAGAGATCAGCCATCTGCATCCAGTCGTGGTGGCGTGGAACACTGGGCCGGAGGAAGGCAGCC
ASPM_MOUSE/2649-2669 AGGGCGGCAGCTATTATAATTCAAAGGAAATGGAGAGCTACACTTTCTGTAAGAGGAGCTCGT
ASP_DROME/1171-1191 AAGCGTGCAGCTATAAATATCCAACAACGCTGGCGAGCGAAGCTTTCAATGAGAAAGTGCAAC
Q9SMY9_ARATH/848-868 CAGTCATCTATTATTGCTATTCAGTGTCGTTGGCGACAGAAGCTTGCGAAGAGAGAGTTTAGA
MYOJ_DICDI/944-964 TTACGTGGTATCATTTTAATTCAAGCAAGATGGAGAATGAAATTGGCCAAAAGGGTTTACATA
MYO52_SCHPO/889-909 CAATATTATGCAGTTCGTATCCAGTCTCTTTGGAGGATGAAACTTGCAAAGCGACAATTGACA
ASP_DROME/1055-1075 TATCACAGTATTATCACCATCCAGCGCTGGTGGCGAGCCCAACAACTGGGAAGGCAGCACCGC
Q9VLZ3_DROME/741-761 CTCAAGAGTATCGTGACAATTCAGCGAGGAATCAGACGGGTCTTGTTCCGACGTTACATGAAG
MYO51_SCHPO/872-892 AAGAAGTCAGTTATTGCTCTGCAATGTGTGTCGCGCTCTGTATTAACCAGAAGATATCTTCGC
O04146_ACECL/907-927 CACAAATCTGCAGTTTTGTTACAAAGGTGGTTTAGACGCGTTTAAAGCCGTAGAAATCTGCGC
MYO4_YEAST/829-849 ACAAGAGCTGCCATATTACTACAAACGAACATTAGAGCATTATGGAAACGGGAATACTATAGA
Q9SSU1_CHACB/791-811 CAGGTCTCAGCAGTTTGTTTCCAAAGGTATATCCGTGGATACCTTGCACAGAAGAATTATTTC
MYSN_ACACA/817-837 ACCGTGTCGGCCAAGATCCTGCAGCGCAACATCCGCGCCTGGCTCGAGCTCAAGAACTGGGCC
SCN5A_HUMAN/1902-1922 GAGGTGTCGGCCATGGTTATCCAGAGAGCCTTCCGCAGGCACCTGCTGCAACGCTCTTTGAAG
SCN4A_HUMAN/1728-1748 GAGGTGTGCGCCATCAAGATCCAGAGGGCCTACCGCCGGCACCTGCTACAGCGCTCCATGAAG
SCN1A_HUMAN/1916-1936 GAAGTATCTGCTGTCATTATTCAGCGTGCTTACAGACGCCACCTTTTAAAGCGAACTGTAAAA
SCN2A_RAT/1906-1926 GAGGTGTCTGCTATTGTCATCCAGCGAGCATACAGGCGGTATCTCCTGAAGCAGAAAGTTAAG
SCN9A_RAT/1888-1908 GAGGTGTCCGCGACTATCATTCAGCGTGCTTACAGACGGTATCGCCTCAGACAACACGTCAAG
SCN3A_RAT/1852-1872 GAGGTGTCTGCTGCTATCATTCAGCGTAATTATAGATGTTATCTTTTAAAGCAACGGTTAAAA
SCN7A_HUMAN/1626-1646 GCAGTTTCAGCAACCATCATTCAACGTGCTTATAAAAATTACCGCTTGAGGCGAAATGACAAA
Q9VGW4_DROME/2683-2703 GAGGAGGCCGCCAAGAAGATACAAACCGCATATCGGATGCACACACGAAAGCGAAAGGGTCAT
ASPM_MOUSE/2763-2783 CACATGTGTGCTCTTAAAATCCAACGAGCTTATCGGCTCCACGTGACCTTGAGGAACGCTAAG
MY31D_DROME/716-736 ATGAAGGCGGCCATTACGATCGTGCGCGCCTATAAGGCCTACAAACTGCGTAGCTACGTCCAG
Q9Y6U1_HUMAN/163-183 ATCAAGTGTGTGACCAGAATCCAAGCCTACTGGAGAGGATGTGTTGTTAGAAAGTGGTACAGA
Q9VB28_DROME/412-432 ATCCAGTGCGCCGTCAGATTGCAGGCCTGGTGGCGTGGAACCATGGTGCGACGCGGTCTGGGA
Q9T0C1_ARATH/122-142 TTGAAAGGAATAGTGAAGCTACAAGCATTAGTGAGAGGTAACAATGTAAGAAACCAAGCAAAA
O64852_ARATH/106-126 TTGAAAGGGATAGTGAGGTTACAAGCTTTAGTGAGAGGAAGACAAGTTAGGAAACAAGCAGCT
Q9SZE3_ARATH/137-157 TTGAGAGGAGTGGTGAAGATTCAAGCTTTAGTGAGAGGTTTTTTGGTACGGAATCAAGCGGCG
Q9SG11_ARATH/132-152 CTAAAAGGAGTTGTGAAACTACAAGCCCTAGTGAGAGGCCATAACGTTCGTAGAAGAACTAGC
O82755_ARATH/189-209 CTCAAGGGTTTGGTTAGGCTTCAAGCGATAGTTAGAGGCCATATCGAAAGAAAGAGAATGTCA
Q9SD11_ARATH/59-79 TTGAAGAGTCTGGTGAAGTTACAGGCGGTGGCTAGAGGAGTGCTTGTGAGGAGACAAGCACGA
O64504_ARATH/143-163 CTCAAAGGTATCACAAGGGTGCAAGCAGTTATCCGTGGTCACTTGGTCAGAAGACAAGCTGTT
ASPM_MOUSE/2725-2745 AAAAAGTCTACGGTTGTTGTACAAGCCTTGGTGCGTGGCTGGTTAGTAAGGAAAAGGGTTTCA
RNG2_SCHPO/330-350 GAGAAAATCGTGAACGCGATTCAAGCTTGTGGTCGTGGCGTACTTGTGCGCTTGCGTTTGGTG
Q9XFK8_MAIZE/844-864 CGGAAGGCCTCAGTGATAATACAGTCTGGTATTCGTGGCAGTCTTGTTCGAAGATGTAATGGC
Q9SNF0_ARATH/912-932 GCCGATGCATCAGTTGTGATACAATCAGCAATTCGTGGTTGGTTGGTTAGAAGATGTTCAGGG
O24515_HELAN/869-889 CATGGCGCGACAATTACGTTACAAGCTGTTATTCGTGGCTGGCTGGTTAGGAGATGCTCAGGG
Q9V3Z6_DROME/806-826 AGGGGCCACATTGTCGGGTTGCAAGCCCATGCCCGAGGATATTTGGTGAGGAGAGAGTATGGT
P91443_CAEEL/805-825 CGAAAGACAATCATCCAATTTCAAGCTGTATGCCGCGGGTCTCTAGTACGTCGTCAGGTTGGA
MYO4_YEAST/804-824 ATGGAATCAATAAAGAAGTGCCAAAGCCAAATTAGAAGTTTGTTGGTTCGTACAAGGGTCGAT
IQG1_YEAST/569-589 CGAGAAAGTATTATGAAGTTTTCGGCAATCATCAGAGGTAACGTTGTGAGGTGTTCAGAGGAC
Q9VLZ3_DROME/810-830 AGGTGTCGAACCATAAAACTGCAGGCCTTGAGTCGCGGGTATCTGGTACGCAAGGACTTCCAG
MYO5A_CHICK/839-859 CGAGATGCTACTATTGCTCTTCAAGCTCTCTTAAGAGGTTACCTGGTCAGGAACAAGTACCAA
Q9VEZ0_DROME/1201-1221 TCAGATCGCATTATACAGCTGCAAGCATTTTGCCGCGGCTACTTGGCACGCAAGAAGATGTCC
MYO7A_MOUSE/814-834 AGACAGCGCATAATAGAGTTCCAGGCCCGCTGCCGGGCCTACCTGGTGCGCAAGGCCTTCCGC
MYH11_CHICK/792-812 ACAGATGTCATTATTGCCTTCCAGGCTCAGTGCCGAGGCTACCTGGCGAGAAAGGCCTTTGCC
Q9SWV4_LYCES/408-428 CGCCAACGAATTATTAAAATTCAGGCTCATGTGAGAGGACACCAGGTAAGGAACAAATACAAA
Q9SID7_ARATH/886-906 AGACAAAGAATCATCAAAATACAGGCTCATGTGAGAGGTTATCAGTTTAGGAAAAACTACAGA
MYO2_SCHPO/759-779 CAAAGACTGATGACTATGCTACAAACAAGGATCCGTGGCTTTCTTCAAAGAAAAATTTTTCAA
O97757_FELCA/776-796 GCCAAGATCATGACAATGCTGCAGTGTCGCCTGCGGGGCTTCCTCATGAGGATCGAGTTCAAG
MYH13_HUMAN/786-806 GTGACGCTGATGACAAGCACGCAGGCGGTGTGCAGGGGGTACCTGATGCGGGTGGAGTTCAAG
MYH3_CHICK/787-807 GCACAGCTCATCACTCGCACACAGGCCAGGTGCAGGGGCTTCCTGATGAGAGTGGAGTTCAAG
IQGA1_HUMAN/746-766 GAAGGCCTGATCACCAGGCTGCAGGCTCGCTGCCGTGGATACTTAGTTCGACAGGAATTCCGA
MYH6_HUMAN/784-804 AGCCGCATCATCACGCGCATGCAGGCCCAAGCCCGGGGCCAGCTCATGCGCATTGAGTTCAAG
MYH7_HUMAN/782-802 AGCCGCATCATCACGCGTATCCAGGCCCAGTCCCGAGGTGTGCTCGCCAGAATGGAGTACAAA
O93498_THECH/784-804 GCAGCTCTGGTCGGGATGATTCAGGCTGCAGGCAGAGGTTATGTCATGAGAAAGGAGTATGTG
O42352_CYPCA/780-800 GTAAATCTGGTTACCATGACTCAGGCTTTGGCCCGAGGATATGTCATGAGGAAGGAGTTTGTC
MY18A_HUMAN/1189-1209 AGCAGGAACCTAACCCTGTTCCAAGCAGCCTGCAGGGGCTACCTGGCCCGCCAGCACTTCAAG
O97417_DROME/894-914 CGTCGCAACATCATCATTTGTCAAGCGGCGATTCGGAGATTCTTGGCCCGTCGTAAGTTTAAA
Q9U0S6_MYTGA/544-564 GGTGCAATCATTTCCATGATGCAAGCCCACATCAGAGCCTTTTTGATCAGAAAGGCATACAAG
MYS_AEQIR/779-799 TCCAAGATCATCTCCATGTTCCAGGCCCACATCCGTGGTTACCTCATCCGTAAGGCATACAAG
O96398_SCHJA/105-125 AACGGTATTATTAGTTTATTCCAAGCCGAAATTCGTGGTTACTTAATGCAAAAACAATACAAG
O96062_DUGJA/775-795 TCTTCCTTGATATCATTATTCCAAGCTCAAATTCGGGGATATTTAATGAGAAAACAATACAAA
MYSA_DROME/781-801 GGCAAGATCATGTCCTGGATGCAGGCATGGGCCCGTGGTTACCTGTCCCGTAAGGGCTTCAAG
Q20641_CAEEL/786-806 ACCGCTTTAATTATGAACTTCCAAGCACAATGCAGAGGATTCCTTTCTAGACGGCTTTACACC
MYSN_DROME/871-891 TCCGATCTTATCGTTAATTTCCAGGCCTTCTGTCGTGGCTTCCTTGCGCGTCGCAACTACCAA
Q9V3Z6_DROME/737-757 ACGCGAAAAATCCTCATTCTGCAGCGCAGCATTCGTGGTTGGGTGTACCGACGAAGGTTTCTA
O97417_DROME/823-843 GCTCGTGCGGGATTAATCCTGTCGAAGTACGCCCGCGGTTGGTTATGCCGTCGTCGTTACTTG
Q9UNJ2_HUMAN/1020-1040 CTCCGCAGAATCATATTGTTGCAGCGATGGTTCAGGGTCTTGCTGTGTAGGCAGCATTTCCTC
Q9SX51_ARATH/857-877 AAAACCGGAATTACTATTCTTCAATCATTTGTTCGTGGAGAAAAGATGAGAAAGGAATACACG
Q9SNF0_ARATH/863-883 AAAAGGAGAATTTCTATTCTCCAATCATTTGTTCGTGGAGAGAAGATAAGAAAAGAGTTTGCT
O24515_HELAN/820-840 AAAAGAGGAATTTTCAACCTTCAAGCATTTGCTCGTGGTGAAAAAACTAGAAAGGAGTTTGCA
MYO52_SCHPO/818-838 TCTTCCAATATTATTAAACTTCAGTCACTTTGGAGAACTGCATTAAAGAGAAAAGAATTCATA
O97417_DROME/775-795 AAGAAGTATATCACCATTGTGCAGTCGGTTGTGCGGCGATTCGTCTACCGGCGCCAGTTCCTG
Q9UNJ2_HUMAN/1139-1159 AGGAAAAAAATTATCCTTTTGCAATCAACATGTAGAGGATTCAGAGCAAGACAAAGATTTAAA
MYO15_MOUSE/1910-1930 CGGCGGAAGATCATCCTACTGCAGAGCAGAGCCCGTGGTTTTCTGGCCAGACAACGCTACCAG
MYO51_SCHPO/776-796 GTAAAATTTATCATTAAACTACAATCGGTTATTATGGGCTGGTTAACTCGTCAACGTTTTGAG
O81486_CHLRE/808-828 CGCCGCCTCATCATGGCGGTGCAGTCCATGTTCCGCGGCCGCAACGCGCGCCAGCGCCTCACG
Q9TYJ9_CAEEL/834-854 AGTGCTCAAGTGACACGTCTACAGTCAATTGCGCGTGGATACCTGACACGTCAACGGTTCTCA
Q9U487_LOLPE/779-799 AGACGTAGCATCTTCCTGTTGCAGGTCTACGGACGAGGCTATCTTGCACGTTTAGCATTCCAA
O97417_DROME/846-866 CGCCACTCCATTTCCGGCATACAGACCTACGCCCGCGGCATGCTGGCGCGCAACAAGTTCCAC
ASP_DROME/1657-1677 CGCTGTTCCATGCCGGGCTTCCAGGCACGTGCCCGCGGCTTTATGGCTCGCAAACGATTCCAG
O97417_DROME/798-818 CAGAAAGTAATTAATGGCATTCAGAAACATGCGCGCGGATATCTTGCTCGCGAGCGTACTCAG
MYO51_SCHPO/753-773 AGCAAATCGACAGTTTTATTACAGTCTGCTATAAGAGGCTTCTTTACTCGGAAGGAGTATCAA
RNG2_SCHPO/419-439 ACGAAGTCAATCCAAACGTTACAAAGCATTATTCGTGGGGGTTTCTATCGTCGTAAATACCAC
RNG2_SCHPO/656-676 ATTCCTGAAATTGTATTGTTACAATCTTTAATTCGTGGGTATCTATCTCGAAACAAATTTTCA
RNG2_SCHPO/360-380 AGTTCTTCTGTCGTACTTCTGCAAGCCGTAATTCGTGGATATATATCTAGAAATACATACAGA
Q9QXI0_RAT/1147-1167 CAAAGGAAGATTGTAACTTGTCAGAAAGTTATAAGAGGGTTTCTAGCCCGCCAGCACTTACTT
O84165_CHLTR/116-136 GAAGAAAAAGTCATTACGCTTCAGAAGTTTTGTAGAGGATTTCTAGTTAGAAATCATTTGCTC
MYO52_SCHPO/841-861 AAAAATTCTATACTTAAAGTGCAAAGTATAATTAGAGGCTTTTTATTAAGACAGACTTTAGAG
RNG2_SCHPO/566-586 ACATCCTCTTTCATTGCTCTACAGGCAATTGTTCGGGCTTTTCTTTTAAGAAAAAACTTGGAA
Q9XFK8_MAIZE/772-792 CTGCATGGTATTTTAAGGGTTCAAAGCTGTTTCAGGGGGCATCAAGCCCGTCATCATGCAAGA
O24515_HELAN/797-817 CTTAACGGTATATTACGTGTTCAAAGCTGCTTTAGAGGTCACAAAGCTCGTCAATATATGAAG
Q9SNF0_ARATH/840-860 CTCCACGGCATTTTACGTGTTCAAAGTTCTTTTAGAGGATACCAAGCACGCTGTCTCCTGAAG
Q39157_ARATH/763-783 CTTCAAGGCATAGTGGGCTTACAAAAGCATTTCCGTGGTCACTTGTCTCGTGCATACTTCCAA
O81840_ARATH/825-845 TTGCGTGGCATACTTGGATTACAGAAGCAATTTCGTGGTTATCAGACTCGTGAATACTTTCAC
O04146_ACECL/838-858 AAAGCCGCAATCATCGTTATTTAATCGTGTTATCGGGGGCATTTGGGAAGAGTCGTAGCATAA
O04145_ACECL/852-872 AAGCACTATATTGTAGTGATCCAATGTTGTTACAGAGGTTTTAAAGGGCGGTAATTAGCTTAA
Q27328_CAEEL/704-724 CCGAATGTAATCACATTCTTGCAAAAAATGGTCCGCGGAGTGCAACAACGTGAGAGATACCGA
MY31D_DROME/694-714 CCACACATTGTGACGCTGCTGCAAAAGCGAGTGCGTGGATGGATTGTGAGGAGAAACTTTAAG
MYO7A_MOUSE/745-765 ACAGACAGAGTCATTCTCCTCCAGAAGGTTATCCGGGGCTTCAAAGACAGGTCCAACTTCCTG
MYOE_DICDI/695-715 CCAAGAATTGTAACATTAATTCAAAAGACATGGAGAGGTTATAGAGCACGTTCCAAATGGAAT
O49705_ARATH/815-835 GTTATCTCTTCTATCACCATCCAATCTTATGTTCGTGGATGGATCACACGCAGAATGAATCGG
RNG2_SCHPO/596-616 CACCTATCTGTCATTAAAGCCCAATCTCTTTATCGGGGATTCATTACTCGAACCAAAATTGAT
RNG2_SCHPO/449-469 ACACCATCATTTGTGTTAATTCAATCCTCAGCTTTAGGATTTCTTACCCGTCATGCAATAGTT
RNG2_SCHPO/536-556 CTGGATAATTTTATTAAACTACAAAATTTATCTCGAGGATTTATGATTCGTCGGGCATTTAAA
Q9VGC1_DROME/233-253 GAACAGGCAGCGAGCGTTCTTCAGAGATTCTTCCGCAAGGTTATGTTGCGCGTGGTTACCAAG
ASP_DROME/973-993 CATGCGGCGGCCACGGTGCTCCAGAAATGGTGGCGCCGTCACTGGCTGCACGTTGTTATCCAG
ASP_DROME/1387-1407 CAGGCTGCTGTGAGCTGCCTGCAGATGCATTGGCGTAATCATCTCCTTAGGAAACGGGAGAGG
Q9U487_LOLPE/875-895 CGTCGTGGCATGGTACTGCTTCAGTCCCATGTACGACGCCGAGCTGCCAAGAAGGTCTTCAAA
MYO5A_MOUSE/886-906 ATGAAAGCCATCGTCTACCTTCAGTGCTGCTTCCGGCGGATGATGGCCAAGCGTGACGTGAAG
Q9U487_LOLPE/756-776 ATCAGATGGTCAGTTATGGTGCAGAAACAAGTCAGGACATTCCTATGCAAGAGACGTTTCAAT
Q17383_CAEEL/927-947 AGGAAAAAGGTGGTCATGGTTCAGTGCGCTGTCCGTAAATGGCTTGCCAAACGTCGTCTCCGG
Q17383_CAEEL/831-851 AGAAGATCTTTGCTCATCGTCCAGGCATCGTTGAAAGCATTCCTCGCATTCCGAAGAATCAAG
Q9SSU1_CHACB/862-882 TTGAGGTCATGTAAAGTCTTCCAAGGTGCCTGGCGATGCAAGGAGGCACGAAGTGAGATCAAG
Q21000_CAEEL/792-812 GGAAAGATCATGGCTAAGTTCCAATGCGCATGCCGTCACTATCTTGCTCAATGTGAATACAAG
O04146_ACECL/885-905 ATTCGTGCCGTCATTGTCATGTAAAAGTTTTCCCGTCGATACGAAGCAGTCAAAGAGTAGAAA
MY61F_DROME/730-750 CGTGCTCAGGTGATCATAATGCAGAGCTACTGTCGCCGAAAGTTGGCGCAGCAGGCGGCCAAG
ASP_DROME/1495-1515 CGCCAGGCAGTCATCCGCTTGCAGAAATGGTGGCGCAGTATACGCGACATGCGGCTGTGCAAA
Q17383_CAEEL/879-899 CGCGATTCAATCATTGGGATCCAGGCAATGTTTAAGGCGAATCGCGTCAGAAGATATGTGGAA
MYO1A_MOUSE/721-740 CGGAAGAGTCAAATCCTCATCTCGGCTTGGTTTCGGGGCAACAAGCAAAAGAAGCACTAT---
O49705_ARATH/777-797 AGGAAATCTGTTTCCGTCATTCAGAAAGCTGTAAGGAGACATCAGAGCAACCTTCATCATGAG