EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00438 alignment
(12 sequences with 303 bp)


METL_PEA/4-104 GAAACATTCCTATTCACATCTGAATCAGTGAACGAGGGACACCCTGACAAGCTATGCGACCAGATCTCTGATGCTGTACTAGATGCTTGCCTTGAGCAAGATCCAGAGAGCAAAGTTGCATGTGAAACTTGCACAAAGACCAACATGGTTATGGTTTTTGGTGAGATCACAACAAAGGCCAATGTTGATTATGAGAAAATTGTCCGTGACACATGCAGGAACATAGGTTTTGTTTCAGATGATGTTGGTCTTGATGCTGACAACTGCAAAGTCCTTGTCAATATTGAGCAACAGAGTCCTGAT
METK_ACTCH/2-102 GATACCTTTTTGTTCACCTCTGAATCTGTCAATGAAGGCCACCCTGACAAGCTCTGTGACCAAGTCTCTGATGCCATCCTGGATGCTTGCCTGAAACAAGATCCTGAAAGCAAAGTTGCGTGCGAGAGCTGCACAAAAACTAACATGGTCATGGTCTTTGGTGAGATAACAACTAAAGCTCAAGTAAATTATGAGAAGATAGTTCGAGATACTTGCAGAGGCATCGGTTTCACTTCACCTGATGTTGGCCTTGATGCTGATCACTGCAAGGTCCTTGTCAACATTGAGCAACAGAGTCCCGAC
METK_YEAST/3-103 GGTACATTTTTATTCACTTCTGAATCCGTTGGTGAAGGTCACCCAGATAAGATCTGTGACCAAGTTTCCGACGCCATCTTGGACGCTTGTTTAGCCGAGGACCCTCACTCCAAAGTTGCGTGTGAAACCGCGGCAAAGACTGGTATGATTATGGTCTTTGGTGAAATTACTACCAAGGCACAGTTGGATTACCAAAAAATCGTCAGAGACACCATCAAGAAGATTGGTTACGATGATTCCGCCAAGGGTTTCGACTATAAGACCTGTAACGTCCTTGTCGCCATTGAGCAACAATCTCCAGAT
METK_NEUCR/15-115 GGAACCTTCCTCTTCACCTCCGAGTCCGTCGGTGAGGGTCACCCCGACAAGATCGCCGATCAGGTTTCCGATGCCATTCTCGATGCCTGCTTGGCCGAGGACCCTCTCTCCAAGGTCGCTTGCGAGACCGCCACCAAGACTGGTATGATCATGGTCTTCGGTGAGATCACCACCAAGGCCAAGCTCGACTACCAGAAGGTTGTCCGCAACGCCATCAAGGACATCGGCTACGATGACTCCTCTAAGGGCTTCGACTACAAGACCTGCAACCTCCTCGTTGCCATTGAGGAGCAGTCTCCCGAT
METK_ASCIM/12-112 GGGTCTTTCCTCTTCACCTCCGAGTCTGTCGGTGAGGGTCACCCAGACAAGATCGCCGATCAGGTTTCCGATGCCGTTTTGGATGCTTGTTTGGCTGAGGACCCATTGTCCAAGGTTGCTTGTGAGACTGCCACCAAGACTGGTATGATTATGGTTTTCGGTGAAATCACCACCAAGGCCCACCTCGACTACCAGAAGATCATCCGTAACGCCGTCAAGGACATTGGTTACGATGACTCCGCTAAGGGATTCGACTACAAGACCTGCAACGTCTTGGTCGCCATTGAGCAGCAGTCCCCAGAT
METK_HUMAN/16-116 GGCACATTCCTTTTCACCTCAGAGTCGGTCGGGGAAGGCCACCCAGATAAGATTTGTGACCAAATCAGTGATGCTGTCCTTGATGCCCACCTTCAGCAGGATCCTGATGCCAAAGTAGCTTGTGAAACTGTTGCTAAAACTGGAATGATCCTTCTTGCTGGGGAAATTACATCCAGAGCTGCTGTTGACTACCAGAAAGTGGTTCGTGAAGCTGTTAAACACATTGGATATGATGATTCTTCCAAAGGTTTTGACTACAAGACTTGTAACGTGCTGGTAGCCTTGGAGCAACAGTCACCAGAT
METK_DROME/27-127 GCTACATTCCTGTTCACTTCCGAGTCCGTTGGCGAGGGTCATCCAGACAAAATGTGCGACCAAATCAGCGACGCTATCTTGGATGCCCATCTGAAGCAGGATCCAAACGCGAAGGTGGCGTGTGAAACCGTCGCCAAGACGGGCATGATTCTGCTGTGCGGCGAGATCACGTCTAAGGCTGTGGTCGACTACCAGAAGGTTGTTCGTGAGACAGTGCAGCACATTGGTTATGATGACTCCTCCAAGGGTTTCGATTTCAAAACGTGCAATGTGCTGTTGGCATTGGACCAACAATCGCCTGAG
METK_CAEEL/4-104 CACAAGTTCCTTTTCACCTCCGAATCTGTCTCTGAAGGGCATCCTGACAAGATGTGTGACCAGATCTCGGACGCTGTTCTTGATGCTCATTTGGCTCAAGATCCTCACGCAAAGGTTGCATGTGAAACGGTGACTAAAACGGGTATGATCATGTTGTGCGGTGAGATCACCTCGAAAGCTGTCGTCGACTACCAGGTTCTCGTCCGAAACGTCATTAAGAAAATTGGATACGATGATTCCTCGAAAGGATTCGATTACAAGACATGCAATGTTCTTGTTGCACTCGAACAACAATCACCTGAA
METK_STAAU/4-104 AACAAACGATTATTTACTTCAGAGTCTGTTACAGAAGGACACCCAGATAAAATCGCTGACCAAGTGTCAGATGCAATATTAGATGCTATTTTAAAAGACGATCCAAATGCACGTGTAGCTTGTGAAACAACTGTTACAACAGGTATGGCATTGATCGCCGGCGAAATTTCTACAACAACATATGTTGATATTCCGAAAGTTGTTAGAGAAACAATTAAAGAAATTGGATACACAAGAGCAAAATATGGTTATGATTATGAAACAATGGCAATTTTAACTGCGATTGATGAACAATCACCTGAC
METK_BACSU/4-104 AATCGTCGTTTATTTACATCAGAATCTGTTACGGAGGGGCATCCGGATAAAATCTGTGACCAGATTTCTGACAGCATTTTAGATGAAATTTTAAAGAAAGACCCTAACGCGCGTGTTGCTTGTGAAACATCTGTGACAACAGGTTTGGTTCTTGTAAGCGGAGAGATCACAACTTCTACGTATGTTGACATTCCGAAAACGGTTCGCCAAACCATTAAAGAAATCGGATACACACGTGCAAAATACGGATTTGATGCGGAAACTTGTGCGGTTTTAACATCAATTGATGAGCAGTCTGCTGAT
METK_HAEIN/2-102 TCTAGTTATTTATTTACATCTGAATCAGTCTCTGAAGGGCATCCAGATAAAATTGCCGATCAAATTTCTGATGCGGTACTTGATGAAATCCTAAAACAAGATCCAAAAGCACGAGTAGCTTGTGAAACTTACGTAAAAACTGGTATGGCATTGGTTGGTGGTGAAATTACAACATCAGCATGGGTTGATATTGAGAATTTAACCCGTAAAGTGATTTGTGATATTGGTTATGAACATTCTGAAATGGGCTTTGATGGTCATTCTTGTGCAGTGCTTAATGCGATTGGTAAACAATCTGCAGAT
METK_ECOLI/1-101 GCAAAACACCTTTTTACGTCCGAGTCCGTCTCTGAAGGGCATCCTGACAAAATTGCTGACCAAATTTCTGATGCCGTTTTAGACGCGATCCTCGAACAGGATCCGAAAGCACGCGTTGCTTGCGAAACCTACGTAAAAACCGGCATGGTTTTAGTTGGCGGCGAAATCACCACCAGCGCCTGGGTAGACATCGAAGAGATCACCCGTAACACCGTTCGCGAAATTGGCTATGTGCATTCCGACATGGGCTTTGACGCTAACTCCTGTGCGGTTCTGAGCGCTATCGGCAAACAGTCTCCTGAC