EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00037 alignment
(494 sequences with 72 bp)


O28629_ARCFU/110-133 TACACCTACAAGTACGAGACATGCAGAGAGTGCACACTCTGCTACAAGGTCTGCCCCACCAATGCCATTAAG
FER7_METJA/38-61 TATGCCTATGATGTAGAATACTGCCACAACTGTAAGTTTTGTGCTGGTAGATGCCCTACAAATGCAATATTA
FWDE_METJA/118-141 GTTGGTATAGACGAAGATACCTGCCATCTATGTGCATCTTGCATATTTAGATGTCCAACAAACTCATTAAAA
O28604_ARCFU/40-63 TACAACAGAGAGCCGGACATGTGCTGGGAGTGCTACAGCTGTGTTAAGATGTGCCCGCAGGGCGCAATTGAC
O33996_CHRVI/35-58 TACAACATCGAACCCAACATGTGCTGGGAGTGCTACTCCTGCGTCAAGGCCTGTCCGCACAACGCGATCGAC
Q59338_9DELT/40-63 TACAACCAGGAACCCGAAGCCTGTTGGGAATGCTACTCCTGCGTGAAGATTTGCCCCCAGGGCGCCATCACC
O29312_ARCFU/93-116 GTGATTCACGATGAGAGTAAATGCGTTGCTTGTTATAGCTGCATCATGGCCTGCCCCTACGGGGCCATAAGA
O28140_ARCFU/30-53 GTGAGAATAGACCAAAGCAAATGCAAGGAGTGCTACGAGTGCGTGAAGGCATGTCCGTACGGGGCGCTAATC
RPOD_METTH/196-219 GTGGTTGTTGACCTTGAAAACTGTTCAATGTGCAAGAGCTGTGTCAGGGCATGTGATAAGAGGGCCATAGAT
PHFL_DESVO/28-51 ATCCAGATCGATGAATCGAAGTGCATCGGATGCGACAGCTGCCAGCAGTACTGCCCCACCGGCGCCATTTTC
PHFL_DESVH/28-51 GTCCAGATCGACGAGGCAAAGTGCATAGGCTGCGACACCTGTTCGCAGTACTGCCCCACCGCCGCCATCTTC
O08311_DESFR/28-51 GTCCAGGTCGACGAGACCAAATGCATCGGCTGCGATACCTGCATGGGCTACTGCCCCACCGGGGCCATCACC
O30081_ARCFU/6-29 ATAGCCATAGACGAGGAGAAGTGCATTGGCTGCGGGAGATGCGTCAACTCCTGCCCCACGGGTGCGCTTGTG
O26942_METTH/102-125 ATAGTCCTCGATGACAGGAAATGTATCGGCTGCAGCTTCTGTGTAAACTCCTGCCCCACAAAGGCCATAGTG
O29112_ARCFU/197-220 CCGCAGATTGATGAAGAGAAGTGCACGAAGTGCGATGAGTGCGTGAAAATCTGTCCAAGCAATGCGATAGAG
O29309_ARCFU/48-71 ATGAGAGAGGACGAGATGAAGTGCGTCGGCTGTCAGAGGTGTGCTGTGATGTGCCCGACAAACGCTCTTGTG
Y1302_METJA/51-74 AAAACCGTTATTGAAGAACTCTGCATTGGTTGTGAGGGATGTGCCAACGTCTGCCCAACTAAGGCAATTGAG
O27308_METTH/48-71 CCCAAGGTCGCCGAGGTCTCATGCATAGGATGCGCAGGGTGCTCCAACGCCTGCCCCACAGGGGCCATTGAG
Q27096_TRIVA/68-91 AAATTACTTGCTGAGACAAACTGCATCGGCTGTGGCCAATGTACACTTGTTTGCCCAACACAGGCCATCCAT
O59116_PYRHO/54-77 CACACTTTAGATTGGAAAAAGTGTATAGGATGTAACTTCTGCGGTCAGATATGCCCCGCTAGGGCTATAGAG
O30289_ARCFU/88-111 TATTACGTGGACGAGAAAAAGTGCGAGGGCTGCGCTTTCTGCTTCAACGTCTGCCCGGAAAGGGCGATAGAG
O28225_ARCFU/26-49 CCAGTTGTTGACGAGAAAAAGTGCTCAGGCTGTAAGGAATGCTTCTACTACTGCCCTGAAGGGGTAATTCAG
Y1684_METTH/364-387 AACGGCCTGGACCTTGACAGGTGTTTCGGCTGTGGAGTATGCGCATGGTCCTGTCCTTCAGGAGCATATGAG
O27111_METTH/4-27 ATAAAGATAGATTCAGATCTCTGTAAGGGATGTGACATATGCAGAGAGTTCTGCCCCGAAGGGGCCTATGTT
O29066_ARCFU/89-112 ACGGTCTTGGACCTGGATTTGTGCATAGGCTGCAAAATTTGCATGGAGGTGTGCCCATTCGGAGCGCCGCAG
Y51B_METJA/275-298 TACGTTATTGATGAGGATTTGTGTATTGGCTGTAGAATTTGTCAGAAAGTGTGTGGGTCAGGGGCTATTAAA
HDRA_METTM/583-606 GCAGTTACAGATTCCGATGTCTGCGGTGGCTGTGAGGTCTGCATTGAGCTCTGCCCATTCGGTGCCATAAGC
O66481_AQUAE/84-107 GTTTACGTGGAACAAACTCTGTGCATAGGCTGTAAAGCGTGCATAATAGCCTGCCCCTACGGAGCTATAACT
O93725_PYRAE/111-134 GTCTTAGTAAATGACGACCTTTGTATTGGCTGTGGCGCGTGTATACAAGCATGTCCATACGGCGCCAGATTC
O67279_AQUAE/99-122 GTTCTCGTGAACTACGACGACTGTATAGGTTGTAAGCTATGTTCCTGGGCATGTCCTTACGGTTGCAGGGAG
DMSB_HAEIN/92-115 GTGATCGTCAATGAAGAAATTTGTATCGGTTGTCGTTATTGTCATATGGCGTGTCCTTATGATGCACCGCAA
YNFG_ECOLI/91-114 GTGGTGGTTGATGAAGATGTTTGTATCGGCTGCCGCTACTGCCACATGGCTTGTCCGTACGGCGCGCCACAG
FDHB_WOLSU/84-107 GTATTGCATGACAAAGAGAAGTGCATTGGATGCGGTTACTGCCTCTATGCCTGCCCCTTTGGTGCTCCTCAA
HMEA_ARCFU/143-166 GTTGAGATAGACATGCACCGTTGCATCGGCTGCAGATACTGCATGATTGCCTGTCCCTACGGGGCGAGATGC
O30062_ARCFU/90-113 GTGCTGGTGGACTTTGAGAGGTGCATTGGCTGCAGGTACTGCATGACTGCCTGCCCTTATGGTGTGAGGCAG
O30285_ARCFU/84-107 GTTCTGATAGACTACGACCTCTGCATCGGGTGCAAGTACTGCATGGTCGCATGCCCTTACCTGGCAAGATAT
Q9Z4S8_SALTI/131-154 GTGGTGGTGGATAACAAACGCTGCGTCGGCTGCGCCTATTGTGTCCAGGCGTGTCCTTACGACGCCCGATTT
PHSB_SALTY/89-112 GTGCAGGTGGATAAATCGCGCTGTATTGGCTGCGATTATTGTGTTGCCGCGTGTCCTTTCCATGTGCGCTAT
PSRB_WOLSU/86-109 GTGAGCGTCAATGTCGATCTTTGCGTTGGATGCCTCTATTGCATCGCGGCGTGTCCCTATCAGGCGCGATAT
NRFC_HAEIN/120-143 GTAGATGTACATAAAGATTTATGCATAGGCTGCCAATACTGTATAGCAGTTTGCCCATATCGTGTACGTTTT
HYBA_ECOLI/138-161 GTCCATTACGACAAAGATGTGTGCACCGGCTGCCGTTACTGCATGGTCGCCTGTCCGTACAACGTGCCGAAG
HMC2_DESVH/135-158 GTCACCTATGACGGCAGCCTCTGCGTCGGCTGTCGCTACTGCATGGTCGCCTGCCCGTTCAACGTGCCGGCC
FER9_METJA/70-93 GTCTATTTAAATGAAGATGTTTGTATTGGTTGTGGTTTATGTGCTTTAGCATGTCCATTTGGAGCTATATTG
Y264_METJA/73-96 GTGGTGGTTATAAAAGATAAGTGTGTTGGTTGTGGTTTGTGTGCTTTAGCATGTCCATTTGGAGCTATAAGA
O26501_METTH/197-220 ATAAGGGTACTCGAGGACAGGTGTATAGGGTGCGGGCTCTGTGTGGATGAGTGCCCGGTGGGTGTCATAGAA
O27769_METTH/62-85 GTGGTCATCCTAGAGGACCGGTGTATCGGTTGCGGCCTCTGCCGGGACGCCTGCCCCGTGGGTGCCATAACC
COOF_RHORU/89-112 GTTCAGATCGTCGAGCAGCACTGCATCGGTTGCAAGCTCTGCGTGATGGTCTGCCCCTTCGGGGCGATCACC
HYCB_ECOLI/75-98 GTGCAGTTGAATGAAAGCCTGTGCGTAAGCTGCAAGCTGTGCGGCATCGCCTGCCCGTTTGGCGCAATTGAA
HYFA_ECOLI/75-98 ATCCAACTCAACGAAAGCCTCTGTATTGGCTGCAAGCTTTGCGCCGTGGTCTGCCCATTTGGCGCAATCAGC
FER2_METJA/105-128 GTAGTATTCAAAGAAGAGGACTGTGTCGGCTGTAAAAACTGTTTAAAAGCCTGTCCATTTAAAGCAATTGAG
O26208_METTH/72-95 GTTAAAATAGATCAGGAATCCTGTGTCGGCTGCAAGCTCTGCATGCTCATGTGCCCCATCGGTGCCATAACC
O27770_METTH/65-88 GATGAGGTGGACCCTGAGAGGTGCATCGGCTGCGGCCTCTGCATGGTGGTGTGTCCCTTCGGCGCCGTCGTC
O27749_METTH/72-95 CTTGTTGTTGATGAGGAGTCCTGCATACTCTGCAAGCTATGCATGGTGGCCTGCCCGGCTGGCATGATTGTG
YSAA_ECOLI/82-105 ATTTTCGTTGAACAAACACGTTGCATTGGCTGTAAAAGCTGTATGCTGGCTTGCCCGTTTGGTGCGATGGAG
AEGA_ECOLI/80-103 ATTCAGGTCAATCAGCAAAAGTGTATTGGCTGTAAATCCTGCGTGGTGGCCTGTCCTTTTGGTACGATGCAA
HYDN_ECOLI/82-105 GTTCATGTGATGCAGGAACGTTGCATTGGTTGCAAAACCTGCGTTGTGGCTTGCCCGTATGGTGCGATGGAA
YFRA_PROVU/58-81 TACTATGTCGATCAGGATAAATGCATTGGTTGTAAAACCTGTGTCTTGGCTTGTCCTTATGGCACTATGGAA
O27432_METTH/169-192 GTTGAGATAAGACTACTCAGCTGCAGGGGCTGCGGCGCCTGCAGAACAGCCTGTCCCCACGGCGCGGTCTCA
Q44302_ANASP/3-26 TATACAATTCCTAACAACAGTTGCGTTGGATGTGACAACTGCCGTCCCCAATGTCCTACGGGTGCAATCAAA
FER3_METJA/3-26 ATAGAAATAAATGAAAACTTCTGTAAGGGATGTGATATATGTATTGTAGTATGTCCAAGAGGAGTATTTGAG
Q9ZLP2_HELPJ/12-35 GTTTGGGTGAATGAAGACAGGTGTAAGGGTTGTGATATTTGCGTGTCGGTATGCCCGGCTGGAGTTCTTGGC
O59110_PYRHO/39-62 ATAGTATATAACGTTGATAAATGCGTTGGTTGCAGAATGTGCGTAACCGTGTGCCCAGCTGGGGTCTTCGTA
P94534_BACSU/71-94 GTCGAACGGTCGCTGTCACTTTGCCTCGGCTGCCGCGCCTGTGAGCCTGTATGCCCGTCTGGCGTGAAATAC
P73119_SYNY3/86-109 ACCATCCAGCATTTTGACAGTTGTTTAGGTTGCTTAGCCTGTGTCAGTGCCTGTCCTTCGGGGGTGCAGTAT
O26499_METTH/288-311 ATCGTGAGGGACCCTGATAAGTGTCTCAGGTGCAGCACATGCTACCAGACATGCCCCTTCGGTGTTGCAGGG
RNFB_RHOCA/105-128 GCCTTTGTTTTCGAGGATCACTGCACCGGCTGCCAGAAATGTTTCAAGCGCTGCCCGACCGATGCGATCGTC
RNFB_ECOLI/140-163 CATACGGTAATGAGTGATCTCTGTACGGGCTGCAATTTATGTGTTGATCCGTGCCCGACGCACTGCATCTCG
RNFB_HAEIN/133-156 CACACGATTATTCCCGATCTTTGTACAGGTTGCGAGCTTTGTGTTGCGCCCTGCCCGACAGATTGTATTTTA
Q59574_METTF/122-145 GCACATGTGGATTCCGAATGGTGCTGCGGGTGTCTCATCTGTGTGGATATGTGTCCAACTGATTCTATAGAA
O74027_METWO/122-145 GCACATATAGAATCTGAAATGTGCTGCGGCTGCCTTATATGTGTTGAGATGTGTCCAACTAACTCTATAGAA
O26296_METTH/57-80 GTACCAGTAAGGCATGAAAACTGTGTAGGGTGCCGCATATGTGAAGAAATGTGTCCTAACAATGCGATAGAG
O29822_ARCFU/35-58 TACCCGGCAAACCCGGACGAGTGTCAGGAGTGCTGCTCCTGCGTTGAGGTCTGCCCTGAGGGGGCAATCACC
O93653_ARCPR/35-58 CATCCTGTGAGACCTGAAGACTGCCAGGAGTGCTGTTCGTGTGTTGAAGCTTGTCCAAACGGAGCCATTTGG
O29252_ARCFU/32-55 GTTGCTGTTAACAGCGATGAGTGCATTGAGTGCTGCGCATGCGTTGAGGCGTGTCCTGAGAGTGCAATTATC
Q46600_9DELT/35-58 GTTCCCGTGAACGAAGAAGAATGCCTGGGCTGTGAATCCTGCGTGGAAGTCTGCGAAGCCGGCGCGATCACC
Q48941_METBA/174-197 TGGGCCAGGGATGAAGATGTCTGCCAGACCTGCCATACCTGTGTGGAAGTATGTCCTGCAAATGCTATTTTC
VHUB_METJA/203-226 TTTGAAGTTAATGCAGAGAAGTGTATTTATTGTCTAAAGTGTGTTGAAGTCTGTCCGGGAGATATGATTAAG
VHUB_METVO/192-215 TCATTCACAGTTACCGAAGAATGTATCGGTTGTGAAAAATGTGTTGAAGTATGTCCTGGTGACATGATTACA
MVHB_METTH/209-232 TTCGAGCTGGATGAGGATGCCTGTATCGGCTGTAACACATGTGTCGAGGCATGTCCCGGTGACTTCATAGTT
MVHB_METFE/209-232 TTTACACTTGATAAAGAGGAGTGTATTGGATGTAATACTTGTGTAGAAATATGCCCAGGAGGATTTATAGAA
FER_RICPR/32-55 CTAGTTATCAACCCTGATGAATGTATAGATTGTGGTGTATGCGTTCCTGATTGTCCTATAGATGCTATTAAA
FER2_RHOCA/32-55 CTGGTGATCCATCCCGATGAATGCATCGACTGCGGGGTCTGCGAACCGGAATGCCCGGCCGACGCGATTCGT
P96093_THIFE/33-56 TTGGCCATCGATCCAGACGAATGCATCGATTGCACCCTCTGTGTGCCCGAGTGTCCGGTAGACGCCATCTTC
FER_MYCTU/32-55 CTCTACATCAACCCCGACGAGTGCGTGGATTGTGGTGCGTGCAAACCGGCCTGCCGCGTCGAGGCGATCTAC
O87086_STRGR/33-56 TTGTACATCCACCCGGACGAGTGCGTCGACTGCGGAGCCTGTGAGCCGGTCTGCCCGGTCGAGGCGATCTTC
FER_BACSC/32-55 TACTACATCGACCCCGACGTGTGCATCGACTGTGGCGCGTGCGAAGCGGTCTGCCCGGTGTCCGCGATCTAC
Q9Z5X2_FRASE/33-56 CTCTACATCAACCCCAACGAGTGCACCGAGTGCGGCGCCTGCGCGTCCGCCTGCCCGATCGGCGCCATCATG
FPRB_MYCLE/39-62 CTTTATATCGATCCTGTAGCCTGTGTGGATTGTGGCGCCTGTGTGAGCGCCTGTCCGGTTGGTGCTATTGCA
FDXN_RHOCA/2-25 ATGAAGATCGATCCCGAACTCTGCACCTCTTGCGGCGACTGCGAACCGGTCTGCCCGACCAATGCGATCGCG
FERV_AZOVI/3-26 ATGGCCATCGACGGCTACGAATGCACTGTCTGCGGCGACTGCGAGCCGGTCTGCCCGACCGGTTCGATCGTC
O28894_ARCFU/591-614 GCTACTGTTGATGAAAAACTCTGCACGGGGTGCGGTATATGCGCGAGCGCCTGTCCTTACGAGGCCATATCC
O27309_METTH/387-410 ACCCTCATAGACCCGAGACTCTGCATAGGATGCGGCCTCTGTCTGGATGTTTGCCCAGAGGATGCCATATCA
Q46507_DESFR/435-458 TACACCATCGATCCCGCCAAGTGCACGGGCTGCGGCCTGTGCACCAGGGTCTGCCCGGTGGAGTGCATTTCC
O27309_METTH/321-344 GATGGATCAGTCTCAGAAGACTGCATATCATGTGGTATATGCTCCGAGTTATGTCCTGTGGATGCCATAACC
Y1303_METJA/375-398 GAGAAAATTAAAGATGAAAACTGCATACTCTGTGGAACATGCTCAAATGTATGTCCAAGAGACGCTATAATA
HDRA2_METKA/288-311 TTCACGATCGACGAGGAGCACTGCATCCGATGCGGTCTCTGCGAAGAGGTATGCGACGCCGACGCGATAGAC
O27597_METTH/134-157 ATCGAGATAGACAAGGAAACCTGTATCTACTGTGGAATGTGTGAGGAGATGTGTCCGGTTGATGCGATAGAG
O27597_METTH/288-311 CTCTACAAGGACGAAAGGTTCTGCATATACTGCGGCGCATGTGAGAGGTCATGTCCCGTTGACGCAATAGAG
O26499_METTH/125-148 TATGTCATAGATGACTACCTCTGCATACGCTGCAAGAAGTGCATGAAGGCCTGCCCGGTGGATGCAATAACC
O27597_METTH/95-118 GCTGAGATAGATGATGAAACATGTATACAGTGCAAGGCCTGTGAAACAGCATGTCCACAGGATGCCATAACC
RNFB_HAEIN/103-126 GCTTTTATTGATGAAAATATGTGTATTGGCTGCACAAAATGTATCCAAGCCTGTCCCGTTGATGCCATTATT
O96948_9SPIT/203-226 GGCACCCTTGATGTTTCTGAGTGTATTCAATGCGGTCAATGCATCAACCGCTGTCCTACTGGAGCCATCACG
NUIM_TRYBB/85-108 TTTACATTGAGTTATCGTCGTTGTATTTATTGTGGTTTTTGTATGCATGTTTGCCCGACAGATGCCATTACG
NQO9_THETH/91-114 TACGAGATCAACATGCTCCGGTGCATCTTCTGCGGCCTCTGCGAGGAGGCCTGCCCCACGGGGGCCATCGTC
NUOI_ECOLI/92-115 TTCCGCATCAACTTCTCACGCTGCATTTTCTGTGGTCTGTGCGAAGAAGCCTGTCCGACCACGGCGATTCAG
NUOI_MYCTU/119-142 TACCAGATTAACTATTTGCGTTGCATCGGTTGCGGTTTGTGCATCGAGGCGTGCCCGACGCGGGCGCTGACG
NUIM_CAEEL/145-168 TACGATATCGATATGACCAAGTGCATCTATTGTGGATTATGCCAGGAAGCTTGCCCAGTCGATGCAATTGTC
Q9ZJV9_HELPJ/114-137 TACACGATCAATTTGGGGCGTTGCATTTATTGCGGGTTGTGTGCGGAAGTTTGCCCAGAATTGGCGATCGTT
HYCF_ECOLI/68-91 TGGGAGTTTAATCTTGGGCACTGCATCTTCTGTGGACGCTGCGAAGAAGTCTGCCCGACGGCGGCGATCAAA
HYFH_ECOLI/68-91 TGGCAGCTCTATCTGGGGCGTTGTATTTACTGCGGACGTTGTGAAGAAGTGTGCCCGACCAGAGCCATCCAG
NUIC_MAIZE/97-120 TATAGTATTGATTTCGGAGTTTGTATATTTTGCGGTAACTGTGTTGAATACTGTCCCACAAATTGTTTATCA
Y51B_METJA/306-329 CCATATATTGTTCCAGAGTTGTGTGTTAGAGGAGGAGCATGCGCAAGAGAATGTCCTGTTGGAGCTATAAAA
O26866_METTH/305-328 CCTGCCATAGACCCTGAGAGGTGCAGGAACTGCAATGTCTGTGTTGAGAGCTGCCCGGTTGAGGCTCTGAAG
O27597_METTH/219-242 TCCTACATCGACCCTGAACTCTGTGTGAACTGTGGATGGTGCCAGGAGATATGCCCTGTTGACGCTGCAACG
Y1043_HAEIN/77-100 CTTGAAATTGACTACGCACCTTGTGATTTGTGTGGTAAATGCGCAGAAGTTTGTCCGACAAATGCACTACAT
O27009_METTH/98-121 CTTGAAATTGATGACGAAAAATGCTTTTTATGCGGTAATTGCGCCGATGCATGTCCAAGGAATGCACTCTTA
O26840_METTH/227-250 CTGGAGCACGACGCAAGAAAATGCCTCATATGCGGCAGGTGCGCTGAGAGGTGTCCTGAAGGTGCCATAAAG
O26501_METTH/10-33 AGTGAGATAGACGAGGATAAATGTGTCCGTTGCAGTTACTGTGCAAGGGCATGCCCCACAGAGGCCATAAAG
FER6_METJA/30-53 GCTATAGTTGATGAAAATAAATGCTCAAATTGTGGGATTTGTGCAAGGTATTGTCCTATAAATGCCATAAAA
Y514_METJA/126-149 TATGAGCTTGATGAAAATACTTGCATAAAATGCGGAATTTGTGCAAGATTCTGTCCAACAAATGCTATAAAG
MVHB_METTH/170-193 ATAGAGATCGATGAGGACACCTGTATAAAATGTGGTGTCTGCGCCCAGACCTGTCCATGGAACGCCGTCTAC
VHUB_METVO/154-177 GCAGTTATTGACACAGAAAAATGTATATACTGTAGTGTATGTGCACAAACTTGTCCATGGAACGCCATATAT
FWDF_METJA/66-89 TTGGATATTGATAAAGATGTCTGTGTTTTATGTGGAATGTGTGCTTCAGCATGTCCATTTGATGCATTGGAT
O27597_METTH/51-74 ATATGCATCGATGAGAACAAATGCGTCCTCTGCGGTATGTGCAGCTCAATCTGCCCATTCCAGGCACTGGAC
O28629_ARCFU/67-90 GTGATTATAGACCACCTCAAATGCGCCTACTGCGGAATCTGCTACTCCTTCTGCCCATTCAACGCCCTTGAT
O27009_METTH/54-77 GTGTCCTTCAACAAGGAGAAGTGTGTTCTATGTGGGTTATGTGCTTCAGTATGCATCTTCGGAGCCATAGAT
O52682_THEMA/601-624 TACACGATAGATCAGGAAAAGTGTGTAAAGTGCGGTCTCTGTGCGAGTAAATGTCCGTTCAAAGCCATAGAG
Y208_METJA/152-175 TATGCAATTGATAAAAAGAAATGCAAACTCTGTTTAAAATGTATAAACGTCTGTCCAAATGGAGCTATAGTT
Y934_METJA/147-170 AAAGAAATTAACCCGGAGAAATGCAAGCTCTGCCTAAGTTGTATTGAAAAATGTCCATTACAAGCTATTTTG
O27309_METTH/195-218 CTCGAAATCGACCCTGAAAAATGCACCCTCTGCCTCAAATGCATGAGGGAATGCCCCAGCAATGCAATATAC
O27592_METTH/556-579 TACATGATAGACCCTGAGAAATGTGATGGATGCATGGCATGCATCAAGACGTGCCCGGCGGAGGCCATAAAT
Q48941_METBA/142-165 ACCAATATTGATACTGAATGCTGTGTCCACTGCGGCTGGTGTGCAGCAGTCTGTCCGGTAAATGCTATTTCT
FWDF_METJA/237-260 ACAGTTATTGATAAAGATGCATGTGTAACCTGTGGATGGTGTGCCTTTATCTGTCCAGCTGAAGCTATTGAA
O26378_METTH/3-26 ACCATGAAGGTTAAGGAATGGTGTATGTTCTGTGGGGAATGTGCAGGTGTATGCCCACGGAACCTCATAGAG
FWDF_METJA/149-172 ATAAACATAAACAAAGAGAAATGTGTTCTATGTGGAATCTGTGCTGAATACTGTCCAGCTGATGCTATTAAT
O27009_METTH/137-160 ATAAATGTATCAATGGAAAAATGCATCTATTGTGGTGAATGTGCAGCTATGTGTCCTGCATCAGCCATTGAA
VHCB_METVO/25-48 ATCAGTTGGGACAGAGAGAAATGTGAATATTGTGGTCCTTGTGCGATAAAATGCCCAAATGATGCTATAATG
Y51B_METJA/45-68 ATTGTTAAATTTCCTGAGAAATGTATATCCTGTGAAGGTTGTAAGGAAAGTTGTCCAGCCTTTGCAATTGAA
MVHB_METFE/2-25 ATAGTTATCAATAAAGAAGATTGTATTAGATGTGGCGCCTGTCAGGGAGTCTGTCCTACAGGTGCAATTAGT
MVHB_METTH/2-25 ATAATCGTCAATAAAGAGGACTGCATAAGGTGTGGTGCCTGCCAGGGGACCTGCCCAACCGCAGCCATTGAG
Y51A_METJA/63-86 ATAACTATTAATAAAGAAAAATGTGTGTTTTGTGGAAAATGCAAAAAAGTTTGTCCAACAAATGCAATTGTA
Y551_METJA/156-179 ATAACCATAAACAAAGAGATTTGCACAAATTGTGGAAAATGTAAAGATTTTTGTGATTTAAATGCTATAGAT
MVHB_METFE/277-300 ATTGTGTACAATGACGAAAATTGTAAATTCTGTGGTAGATGTGCACTAAATTGTCCAAATGAGGCTATACGC
Y1303_METJA/469-492 GGAGTTATTGATAAAGAGAGATGTGAGTTCTGTGGAGCTTGCTACAATATTTGCCCAACTAAAGCGATATAT
Q48941_METBA/316-339 AAAGTCATAGATCAGGACCGCTGTGGAGCAGATGGAGCCTGCGCCATGATCTGCCCTGTTGATGCGATCAGG
MVHB_METTH/278-301 CTTGTCTGGGATGAGGAGAAATGTGACTTCATAGGCGCATGCGCCAACATCTGCCCCAACGACGCCATAAGG
O29339_ARCFU/32-55 GCTTACGTTGATGAGGATGCCTGCATGGAGTGTGGCGCTTGCGTGAGGGCCTGCCCCAACAACGCCATCAGC
FER_METTE/33-56 GCAACAGTAGATGAAAGTGAATGCCTTGATTGCGGCTCATGCGAGGACGCCTGCCCCAACAATGCAATCACA
O29030_ARCFU/569-592 GCATACGTTGATGAGGAGAAGTGCATTGGATGCAGAATCTGCGAGAAGGTTTGCGAGTTCAATGCCGTTACC
O29628_ARCFU/277-300 GCTTATGTGGACGAGGACATGTGCATAGCCTGCGGCGTTTGCGAGGAAAGGTGTCCCTTTGAAGCCATAACG
O29005_ARCFU/283-306 GCGAGCGTTGATTCATCGAAGTGCATTGCCTGCGGTATATGCATGCTCCGCTGCCCCATGAAGGCTGTGAAG
O27309_METTH/417-440 ATGATAGTTGATGATGATAAATGCATACACTGTGGTGCATGCTCCAACATATGCCCTGCCAGGGCTGTCATA
O28894_ARCFU/233-256 ACTTATGTTGACTGGGACAAGTGCATAGGCTGTGGGGCGTGTGTTGAGGCCTGCCCTCCAAGAGCGGTTACT
ASRC_SALTY/173-196 ATGCGCTTCACTGCCGATCGCTGTATCGGTTGCGGCGCCTGCGTGAAGGCCTGTAGTCACCACGCGGTAGGC
Y51A_METJA/138-161 ATAAGGATTGATATAAATAAGTGTGAGCTTTGTGGAAAGTGTGAAGAAATTTGCCCGTTAAATGCTATAATA
Y51A_METJA/32-55 ATTATCGTTAAAGAGGATAAATGCATTAGCTGTGGAAAATGTATTGAAATCTGCCCAGTGAATGCAATAACC
O74028_METWO/187-210 ATACGCGTTGACGAGGACAAATGTGTACACTGCGGCATATGTAAGAGAATCTGTCCGGTTGACGCCATAATG
Y1303_METJA/222-245 GGAGAAGTAGATTATAATAAATGCATTCTCTGTTTAAAATGTGTTGAAATCTGCCCTAACGATGCTTTAAAA
O29968_ARCFU/9-32 ATATTGGTTGATTATAACAAATGCATCAGCTGTGGAATCTGCGTTTCTCTCTGTCCTCACGATGCTCTGCAA
O27309_METTH/350-373 ATAGAGGTGGACACCGACAGATGCATACTGTGTGAGAAGTGTGGCATACACTGCCCTGTCGATGCGATACCC
O26501_METTH/305-328 GTTGAGGTCGACGCTGATAGATGCATACTCTGCGGTGAATGCCAGGACATATGCCCTGTAACAGCTGTAAGG
O26505_METTH/230-253 GTTGTGGTTGATAAGGATAAATGCATTCTATGTGAGGTTTGTTCCACAAGGTGTCCTGTGGCAGCACTGAAA
O27854_METTH/187-210 AAACCGGTTATAACAGGGGATTGTAACCTTTGCGGTGTCTGTGTGGAGGACTGTCCTGTGGAGGCCATCACT
O26501_METTH/277-300 GTTGAGGTAGACCACATGGTCTGCCAGAGGTGCGGTGTATGCGTTAACCACTGTCCCGTTGATGCCATGACC
O28629_ARCFU/232-255 ATAACCATTGATCAGGAGCTATGCTCTCACTGCTCCTACTGCGAGGAGGTTTGCCCATACGATGCTGCGAAA
O26208_METTH/163-186 GCAGCAGCAACCCAGGGGCTCTGCGTATTCTGCGGCACCTGTGAAATCGTCTGCCCAACAGATGCCATAAAG
O26505_METTH/201-224 CTCCTGGTTGACCAGGATGCCTGCGTCGAGTGCCTTGTCTGTGAGGAGAACTGTCCCACCGGGGCCATAAGG
Y514_METJA/193-216 ATTGAAGTTGATAAAAATCTATGTGTTGGATGTTTAGTTTGTATTGAAGAATGTCCTATCAACGCAATTGAT
FWDF_METJA/189-212 ATTGAAGTTGATAAGGATAAGTGTGTCTTCTGTAAGGTTTGTGAATTCGTCTGTCCGCATGATGCTATTGAG
FWDF_METJA/110-133 ATTAAAGTTTATCAAGACAAGTGTGTTTTATGTGAGCAGTGTGAAATGGTTTGTCCTCAAGGGGCTATAGTT
O28629_ARCFU/192-215 ATTCTGATTGACGAAACTGCCTGCGACTACTGCAAGCTCTGTGAAGAGGTTTGCCCTGAGGAGGCCATAAAG
P72318_RHORU/35-58 GTGACCTTTGACGAGACCGCCTGCGTCGGCTGCAAGATGTGCGAGCACGTCTGCCCGGGCGGGGCGATCCGC
IORA_METTH/590-613 GTGTTCATAGACCCTCTAAAGTGCAGGGGATGCAGTGTATGCCTCCAGATATGTCCCGCAGGAGCAATAAAA
O58865_PYRHO/589-612 GTTAGGATAGATGAGCTAATATGTACCGGCTGTGGAATCTGCAACCAACTCTGTCCTTTCGATGCTATAAAG
IORA_ARCFU/595-618 GTCAGCATTGACCAGTCCCTCTGCGTGGGATGTGCTGTCTGCGCGAAAATCTGTCCGAACAGAGCGATTAAG
O33152_METMA/129-152 GACCAGATAGACCTGCTTAAATGCAAAGGCTGCGGGATCTGCAAAGAACTCTGCCCCTATAATGCTATAAAA
Y208_METJA/181-204 GTTGAGATATTATTATCTAAATGCTTAGGATGTGGAAATTGTAAAAAAGTTTGCCCTTATAATGCAATAATT
Y934_METJA/40-63 AAGCCTATACAATTAACTGAGTGCATTGGTTGTGGTTTATGTGTAGATGTATGCCCTACAAATGCAATAAAA
Y514_METJA/222-245 GTTAAGATTAATAAGGATAAGTGCATATTGTGTGGAAGATGTGTAGATGTATGTCCAACTAATGCCATAAAG
O28225_ARCFU/54-77 GCCAGAATCGACTACAGGTTCTGCAAGGGGTGTGGAGTTTGCGGGGAGGTATGCAGGCAGAAGGCGATTGTA
PORD_METJA/57-80 TTCAAAATAGATTATGATTACTGTAAAGGTTGCCTAATATGTATGAACGAATGTCCAGTAAATGCAATAACA
VORD_PYRHO/76-99 GTTGCAATAGATTACGATTACTGTAAGGGTTGTGGTATATGCGCAAATGAGTGTCCTACTAAGGCGATAACC
O28573_ARCFU/62-85 GCAGTTGTGAACTACAACTACTGCAAGGGATGCGGCATCTGTGCCTCAGTCTGCCCCTTTGAGGCCATTAAG
PORD_THEMA/63-86 AAAGGTTTCAACTACGACTACTGTAAAGGATGCGGACTCTGTGCGAACGTATGTCCAAAGCAGGCCATAGAG
O52682_THEMA/571-594 TACGTCATCAATCCAGATATCTGTAAAGGTTGTGGACTCTGTGCCAGATCCTGTCCACAGAACGCCATAACC
FRHG_METJA/171-194 AAAGTTGTCAATAAATCCCTTTGCATGGGATGTGGAACTTGTGCTGCTGCTTGTCCAACAAGAGCTATAGAA
FRHG_METVO/184-207 GAAGTTATTAATAAATCGCTCTGTATGGGTTGCGGAACTTGTGCGGCAGCTTGTCAAGTTAACGCAATAGAC
FRHG_METTH/173-196 AAGGTTGTAAACCAGGGTCTCTGCACTGGATGTGGAACATGTGCAATGGCCTGCCAGACAAGGGCCCTTGAC
NAPF_ECOLI/134-157 CCGCAACTTAATAGCCAACTTTGCAACGGATGTGGAGCATGTGCAGCCAGCTGTCCGGTATCAGCCATAACT
O33163_METBA/182-205 GACGTGATTAACCAGGGCCTCTGCATAGGCTGTGGCATCTGTGCTGCATCCTGTCCAGTGCGGGCGATCACG
O27241_METTH/96-119 CCTGAAATAAATGAATTTCTCTGTGAAGGATGCGGAGCATGTGCATATATATGCCCTGATAGAGCGATAGAC
O27009_METTH/14-37 TTGAATTACAATCCGGATCTATGCACGGGTTGTGGGTTATGTTCAGAGACATGCCCTGTGAACGCTATAGAT
FWDF_METJA/26-49 CTCTGTTGGAACGATGAACTATGTGTTGGATGTGGTATCTGTGCAGATATCTGCCCAGTTAATGCCATTGCT
FWDG_METJA/53-76 ACTGTAGTCAATCAAGATTTATGTGGTGGATGTGGAGCTTGCATAGAAGCATGCCCAGTTAATGCTATAGAG
FWDF_METJA/306-329 ATCATTGTAAATCAAAACCTCTGTGTGTTGTGTGGAGCTTGTGCTAAAGCATGTCCAGTTAATGCTATAAAA
Y514_METJA/156-179 ATTGAGGTTAATTTAGATTTATGTATGGGTTGTGGTGCTTGTGCTGAGGTCTGCCCAAAAAAATGTATAAAG
FWDG_METKA/53-76 TCGGTGATTAACGAGGACCTGTGCGAAGCGTGCATGACCTGCGAACTCGCCTGCCCCGTGGACGCTATCGAG
Y578_METJA/94-117 TTTAAGATAAATCCAATACTGTGTGAAGGTTGTGGAGCTTGTGAGCTAATCTGTGAATTTGATGCAATAGAG
FER6_METJA/2-25 GGGATAAAGATATTAGAGAAATGTGTTGGTTGTGGGAACTGTGTTGTATTTTGCCCAAGAAGAGCAATAAAA
VHUB_METVO/125-148 CCTATCAAAGTGACAGAAGCTTGCGTAGGTTGTTCAGAGTGTGTACCAGTTTGTCCGGTGGATGCTATTTCA
MVHB_METTH/140-162 CCAATATTCATAGCCGAC---TGTGTGGGCTGTGGAATGTGTGTCCCTGAATGTCCTGTGGACGCCATAACC
VHUB_METJA/135-158 CCGATAGCAGTTACTGATGCTTGTGTTGGTTGTGGAATTTGTGTTCCTGAATGTCCAGTTAATGCAATAACC
O26501_METTH/226-249 CCCGTGAAGATACTTGATGGGTGTGTTTTCTGCGGAAGATGCAGGGGCGTATGCCCGGTCGATGCCATCGAG
Q59576_METTF/54-77 AACATAAAAAACCCTGACCTTTGCGGAAAATGCGGCACATGTGTTGAAAGCTGCCCTGTGGACGCAATAAGA
O27242_METTH/95-118 CCAATTCTTGTCAGGGATAGATGCAGTGGCTGTGGGACATGCAGTCTTTCATGCAGAAATAATGCAATAAAG
Q01512_METFE/44-67 CCTATTATTTCTGAAAAATTATGTTCTGGTTGTGGAATATGTGTAAAGAAGTGTCCATTTGACGCCATCAAT
Y719_METJA/55-78 CCAGTAATATCAGAAGTTTTATGTTCTGGCTGTGGAATATGTGTTAAGAGATGTCCATTTAAGGCAATATCA
Q03195_YEAST/48-71 GCATTCATTTCCGAAATCTTGTGTATTGGTTGTGGTATTTGCGTTAAGAAATGTCCATTTGATGCTATTCAA
O30231_ARCFU/42-65 GCCGTCATATCCGAGAATCTCTGCGTTGGATGCGGAATATGCGTCAAGAAGTGCCCGATGCACGCCATCTGG
ABCE1_MOUSE/48-71 GCATGGATTTCTGAAACTCTCTGTATTGGTTGTGGTATTTGTATTAAGAAATGTCCCTTTGGCGCCTTATCA
O58589_PYRHO/44-67 CCAATAATTCAGGAGGCAAGCTGTACTGGTTGCGGAATCTGTGTCCATAAGTGTCCTTTCAAGGCTATTAGC
O27309_METTH/3-26 ATGTTCATATCAACAGGAAAATGTGAGGGACTCGGGGAATGTGTTAAGGCATGCCCTACAGAAGCCATAAGG
O29030_ARCFU/597-620 GCTAAAATCAACCCCAACGCCTGTGCGATGTGTGGAATATGCGTTGCTGCATGTCCCGCTGATGCTATAGAC
Y726_METJA/162-185 AAGCCAATAAATGATGAGTTCTGTACTGGTTGTGGAACATGCGTTGCTAAGTGTCCAGCAAACGCTTTAACA
FER_METTE/3-26 GCAAAAGTTAATGTCGACCTCTGTACTGGCTGTGGAAGCTGTGTAGACGAATGCCCTGCCGCTGCAATTTCC
O29892_ARCFU/16-39 GCTGTGGTTGATGCTTCGCTGTGTGATGGCTGCGGCACTTGTGTAGATGAGTGCCCTGTTGGGGCTATAGAG
HDRA2_METKA/612-635 GCCGAAGTCACGGCCGCTTTGTGCAAGGGATGCGGGACCTGCGCGGCGGCGTGCCCGAGCGGTGCCATGGAG
HDRA2_METKA/579-602 TCGGAGGTGGACGAGGAGATCTGCGGCGGTTGTGGTACCTGCGTGGAACTCTGTCCGTACGGTGCCATAGAA
O28822_ARCFU/78-101 ATTTCAGTGCTGAGAGAGAAGTGCGATGGATGCGGCAAATGCGTTGAAGCCTGCCCTTCAGGGGCTCTCGAA
O29569_ARCFU/313-336 GCCAGCGTCGATGCTGAAAAGTGTTTGGGTTGTGGAGTTTGCGTGCCAACATGCCCGATGGAGGCAATTGAG
O29628_ARCFU/305-328 GCGAAGGTTGACGAGGAGAAGTGCTTCGGCTGCGGGGTCTGCGTTGTTGGATGCGAGCAGGAGGCGATTAAG
O26505_METTH/164-187 GCGGTGGTCGATGAATCCATCTGCATTGGCTGCGGGGCCTGCGTCAACGTCTGCCCCTCAGATGCGGTGGAA
IORA_PYRKO/618-641 GCAAAGGTCGACCCAACGATGTGCTGGGGCTGCGGTGGATGTGCCCAGGTATGTCCGTTCGATGCGTTCGAG
O27754_METTH/19-42 TTGAAGCATGATAAATCAATCTGTATGCGGTGCGGTGCCTGTGTTAGTGTCTGTCCATTTGACGTCCTTGAA
O28894_ARCFU/619-642 GCTGAGGTTGACACGAGAAGGTGCAAGGGGTGCGGAATCTGCAGCTCCGTCTGCCCTGCCAACGCTGTTGAT
O25737_HELPY/81-104 AAGGGCGTGGATTATTCTCATTGTAAAGGCTGTGGCGTGTGCGTGGATGTCTGCCCCACCAACCCTAAATCG
O28624_ARCFU/73-96 CTTATAGTGGATGAAAGCCTCTGCGTAGGTTGCGGTAACTGCGTTGTTGTCTGCCCCGTTCACGTTGAGAAA
Q48941_METBA/267-290 CTGGAAACTGATGAAGCTGCATGCTTGGGCTGCGGAAACTGTGTAATTGTCTGCCCGGTGAATGCCCTTTCT
Q59576_METTF/5-28 CTTAAGGCATACCCTGAACTCTGCCATGGATGCGGAAACTGTGTGATCGCATGTCCCGTGAACGCCCTCAGA
FWDG_METJA/6-29 TTGGTAGTTTATCCAGAAAGATGCCACGGATGTGGAAACTGTGTTGTCTCATGCCCAGTTAATGCTAAACAT
FWDG_METKA/4-27 ATAGTCATTCACGAGGAACGTTGTCACGGATGCGGTAACTGCGTGATCGCTTGCCCGGTCAACGCTTGTAAT
Q46178_CLOPE/86-109 GTAGTTAGAGATGGAAGCAAATGTATTGGTTGTGGAGAATGTGTTATGAATTGCCCAACAAATGCATGGACA
ASRC_SALTY/205-228 GCGGTCAAAGAAGAGTCCGCCTGTATCGGCTGCGGCGAGTGCGTGCTGGCCTGTCCGACGCTGGCCTGGCAA
O28811_ARCFU/10-33 GTCGTGGAGCAGATAAGCGGATGCATTGGTTGCGGGACATGTGTTGAAGTGTGCCCTACCGATGTTTTCCGG
PSAC_MARPO/3-26 GCAGTCAAAATTTATGATACATGTATTGGTTGTACTCAATGTGTAAGAGCTTGTCCGACAGATGTATTAGAA
O29594_ARCFU/144-167 TACTACATTGACGACAAATACTGCAATAAGTGCGGTGAATGCGTTTCTGCATGCAAGTACAACGCCATAGAC
O28629_ARCFU/28-51 CTCTATTACGATTACAAGTGGTGTAATGGATGTGGAATTTGTGTTTATGCCTGCCCTGTCAACGCAATCGAG
Y1043_HAEIN/141-164 TTAGAGATTGATAATGAACGTTGCAATGGGTGCGGAGAATGTAAAATTACCTGTTTTGTCGCAGCCATTACA
O29339_ARCFU/3-26 GCTGTAATAGATGCGGCAAGATGTGACGGATGCGGGCTTTGCATTCCAGAGTGCAAGGGAAATGCCATCCAC
VHUB_METVO/4-27 ATTAAAATTCAAGAAGATGCATGTCTTGTTTGTAATGCTTGTTCAAAAGCATGTCCAACCGAGGCAATAGAA
VHUB_METJA/6-29 ATAACAATTCAAAAAGATGCTTGTTTAGTCTGTTATGCGTGTCAGGCGGAGTGTCCTACCAAAGCAATAGAT
RNFB_RHOCA/135-158 CATACCGTGGTGATGGACGCCTGCATCGGCTGCGACGCCTGCATCGAGGTCTGCCCGACCGAGGCGATCGTC
Q48941_METBA/210-233 ATCACTCACCGTCCAGATGCCTGCATTTACTGTGGGGCCTGTGCGGTTGCCTGCCCTGTTGACGCCATAGAT
O27309_METTH/28-51 ATCGATGGCAGGGCCTTCAGCTGCATAACCTGCGGCGCCTGCATGGAGGCCTGCCCCAACAAGGCAATACGC
FER_THEAC/116-139 GATCCTGTCCGTGAATCGGATTGCATATTCTGCATGGCTTGCGAGAGCGTCTGCCCTGTGAGAGCAATAAAG
FER1_SULTO/76-99 GATCCCGTTAATGAACAGGCATGTATATTCTGTATGGCTTGTGTAAACGTATGTCCAGTAGCTGCAATTGAT
O28629_ARCFU/301-324 GTGCACTTCAACGAGAAGTTCTGCATTTACTGCGGTGCGTGCGAGAATGCCTGCCCGTATGACCTGATAAAG
Q44508_AZOVI/3-26 TACAAGATCAACGGTTCCGAATGCACTGCCTGCGCTGCCTGCGAGTCCGAGTGCCCGAACGACGCCATCCAT
FDXN_BRAJA/3-26 TTCAAAATCATCGCCTCGCAGTGCACGAGCTGCTCAGCTTGCGAGCCTTTATGCCCGAACGTTGCTATTTCG
FDXN_RHIME/3-26 TTCAAGATTATTGCATCTCAATGCACTCAGTGCGGCGCCTGCGAGTTTGAATGTCCGCGGGGGGCGGTCAAT
FER1_RHOPA/2-25 TACAAGATTGTTACCTCCCAGTGCACCGTCTGCGGTGCGTGTGAATTCGAATGCCCGAACGCTGCGATCAGC
FER_CLOPA/1-24 GCATATAAAATCGCTGATTCATGTGTAAGCTGTGGCGCTTGTGCTTCAGAATGTCCAGTTAATGCTATAAGT
Q9ZI14_CAMJE/2-25 GCTGTAAAAATTACAGATATATGTATTGCTTGTGGTTCTTGTATTGATGAGTGTCCAGTGAGTGCTATCGTT
Q53043_RHORU/2-25 GCCCTGAAGATCACCAATGAATGCATCAGCTGCGGCGCCTGCGAGCCGGAGTGCCCCAACGAAGCGATTTCC
FER_CHRVI/1-24 GCCCTGATGATTACCGATGAATGCATCAATTGTGATGTCTGCGAGCCCGAGTGCCCCAACGGCGCCATCTCG
YFHL_ECOLI/2-25 GCGTTGTTAATCACTAAAAAATGCATCAATTGTGATATGTGTGAACCCGAATGCCCGAATGAGGCGATTTCA
O88151_THAAR/2-25 GCCTTGTACATCAACGACGACTGCACGGCGTGCGACGCCTGTGTGGAAGAGTGCCCGAACGAGGCGATTACC
O07464_RHOPA/2-25 GCGCTGACGATCAACGAGGACTGCACGGCCTGCGACGCATGCCGGCCGGTGTGTCCGAACCAGGCGATCTCC
O25054_HELPY/2-25 TCATTATTGGTGAATGATGAATGCATTGCGTGCGATGCTTGCAGAGAAGAATGCCCTAGTGAGGCGATTGAA
FDXN_ANAVA/2-25 GCTTACACAATTACTAGCCAATGTATTTCCTGCAAGCTCTGTTCGTCTGTATGCCCCACTGGTGCAATTAAG
O09255_SYNP8/2-25 AGTTACACCATTACGTCTGATTGTATTGCTTGCGATCGCTGTCGGGTTCAATGTCCCACTAACGCAATTCGC
O27010_METTH/47-70 CCCCTTGTGATAAATGATAAATGTGATAATTGTAGGCTTTGCATCTCTAACTGTCCAAACGGCGCTATTTCT
FERA_METJA/2-25 GTAAAAATAGACTACAAAAAGTGTGGTTATTGTGGAGCGTGCGTTGGAGTTTGTGAAAAGTTAGCTATCAAT
O29082_ARCFU/75-98 GTTCAGAAGGACGATGAGAAGTGCGTTCACTGCGGTGCCTGCGTAAGCATCTGCCCGACGGAGGCGATATAC
O26942_METTH/72-95 GTTAAGAAGGACCGTGAGAAGTGCATGGACTGTGGTGCCTGCGTATCCCTCTGCCCGGTTGGCGCCATATGT
O29892_ARCFU/44-67 GCTCATGTGGATGAAGAGATATGCACTGAATGCGGAGCTTGTGTAGACGTGTGCCCAACTGAGGCGATTAGC
FERN_AZOVI/2-25 GCGCTGAAAATTGTGGAATCCTGTGTCAATTGTTGGGCATGTGTCGATGTCTGTCCGAGCGAGGCGATCTCC
O27009_METTH/220-243 GTCATAACAATTGATGAAAGATGTGCTCACTGTGGTTGGTGTATGGAAATATGCCCGGCAAATGCGATCACC
Y51A_METJA/109-132 ATTGATTATATAAGTGAGAGATGTGCATCTTGCTTAGTTTGTTTAAGGAATTGCCCATTTAATGCTATTGAA
PHFL_DESVO/59-82 AAGATTCCCCACGAGGAACTGTGCATCAACTGCGGCCAGTGTCTGACCCACTGCCCCGTGGGCGCCATCTAC
PHFL_DESVH/59-82 TCCATTCCCCACATCGAGGCGTGCATCAACTGCGGCCAGTGCCTCACGCACTGCCCCGAGAACGCCATCTAC
O08311_DESFR/59-82 AAGGTGGTCGATCCGGCCGCCTGCATCAACTGCGGCCAGTGCCTCACCCACTGCCCGGTTGCGGCCATCTAC
O68393_THAAR/91-114 TACTATTACAACCGTGATCGTTGCGTGAGCTGCGGACGGTGTGCAACGGTCTGCCCAACCGGTGCATCGCAG
O87941_THAAR/48-71 TTCTATTTTTATCCGGATCGCTGTGTCGGCTGCGGTCGCTGTGTAGCCGTCTGTCCCGCCGAAACGTCCCGC
O26380_METTH/558-581 CCCGTAACCTCTGAGGATCTCTGCAATGGCTGCGGAAGATGTGAAGAGGTCTGCAAGGTTGAGGCAGTCAGC
Y870_METJA/488-511 CCAAAGGTAAATGAAGAAAAATGTAACGGTTGCGGAAGATGTGCTGAGGTTTGTAAGGTTGAGGCAATTGAT
HDRA2_METKA/241-264 CGGTACGTGGACGAGGACGCGTGCACGGGCTGCGGCGCGTGCGCGGAGGTCTGCCCGATCGAGGTGCCCAAC
O29594_ARCFU/97-120 CCGAGATACGTCAACGAGAACTGCACAGCATGCGGGGCTTGCAAGGAGGTTTGCCCGATTGAGGCTCCGGAC
O30290_ARCFU/56-79 GTTCCTGAGGTGAGGGAGAACTGCAACGCATGCGGAGTGTGCAAGGACGTCTGCCAGTATTCTGCCATCTAC
FER1_METJA/53-76 GTTGTTAAAAATGAAAATAACTGCACAAAGTGTGGGGAGTGTTTAAAAGTTTGTAGGTATGGAGCAATAATA
Q9ZH19_DESTE/34-57 TTTGTGGCCAACCCCGATGATTGCCTGGGGTGCGAAACTTGTGTCTCTGTTTGCCCGTCGGGGGCTGTAACC
O27309_METTH/170-193 GTTGATACCGGGGAGGGCGTATGTACGGAGTGCCGTGTCTGTGAGGATGTCTGTCCGGTCGGTGCAATAGAG
O27309_METTH/146-169 GTGGTCACCGACACAGATAGATGCACCCTCTGCAGGAGGTGCCAGTACTACTGCCCCACCGGCGCCATTATC
O26505_METTH/135-158 AACATAGAGGTCACAGATAGATGCACTGCATGCGGGACCTGCACCAGGTTCTGCCCCACAGGTGCAATTCAG
O27178_METTH/57-80 GAGGTCCAGCACCCTGAGGAATGCAATGAATGTGAGGTGTGCATGGACGTATGTCCAAACGAGTGCATAGAG
O58006_PYRHO/601-624 ATCGTTGTTTCATTAGAGAAGTGTACACACTGTAGGGAATGCATGAATGTTTGTCCATTGGTTGTGATCAAA
Y1351_METJA/41-64 ATTATTAGCTACTCAAACAGATGTGGAGCTTGCCATAGATGTGTTGTAATGTGTCCAAGGGATGCAATAACA
O28811_ARCFU/40-63 GTAATCAAGTATCCCGAAGACTGTCAGATTTGCCACCTATGCCGGCTTTACTGTCCGGTGGATGCAATCACA
O59657_METBA/35-58 ATTGTTTTTGACCCTGAGAACTGTATTCTCTGCGGACTATGTCAAAAGAAATGCCCGCCTGATGCAATAACA
MVHB_METTH/239-262 ACAGTTGAACTGCCAGCCATCTGTACGGCATGTGGACTCTGTGAACAGCTCTGTCCTGTTGACGCCATAGAC
MVHB_METFE/238-261 ACAGTTTCATTACCAGAGATTTGTCCAGCATGTGGTCTTTGTGAAAAATTATGTCCAACAGATGCAATTGAA
VHUB_METVO/222-245 ATTGTAAAATTGCCAGAAGCTTGTCCTGCATGTCACTTGTGTGAGCAAAACTGTCCTGTGGATGCTATTTCC
VHUB_METJA/233-256 ATCGTTATTCCACCAAAATCATGCCCAGCTTGTAAGCTCTGTGTTAATATCTGTCCAGTCGATGCTTTAGAT
O27111_METTH/41-64 GTCCCGGAAAATCTGGAAAAATGCACGGGATGCAAGCTCTGCATGCTCCTGTGTCCAGATCAGGCGATAGTG
FER3_METJA/40-63 ATCCCAGTAAATCCTGAAAAATGCACAAAGTGCAATCTCTGTATATTACAATGCCCAGACCAAGCTATATCA
PORD_THEMA/33-56 CCTATTCTTCACAAAGAGAAATGTATAGACTGTATGTTCTGCTGGCTCTACTGTCCAGATCAAGCGATCATC
NUOI_ECOLI/53-76 GACCCGGACGGCGAAGAGCGTTGCGTAGCCTGTAACCTCTGCGCGGTAGCCTGCCCGGTCGGCTGTATCTCG
NUOI_MYCTU/74-97 TATCCGGACGGCCTGGAGAAATGCATCGGCTGCGAGTTGTGCGCCTGGGCCTGCCCGGCCGACGCAATCTAT
NQO9_THETH/46-69 CACCCGAACGGGCTAGAGAAGTGCATCGGCTGCTCCCTCTGCGCCGCCGCCTGCCCCGCCTACGCCATCTAC
NUOI_RHOCA/57-80 TACCCCTCGGGCGAGGAACGCTGCATCGCCTGCAAGCTTTGCGAGGCGATCTGCCCGGCGCAGGCGATCACC
Y514_METJA/40-63 TTATATATCAACGAAACTAAATGTATTAGATGCAATCTTTGCTACAAAGAATGCCCAGTAGATGCAATTGAA
O26505_METTH/51-74 TTCATAGACATAACACCGAAGTGTGTAAGGTGCAATCTCTGTTTTGAGGAGTGCCCTGTGGACGCCATATCA
O29029_ARCFU/47-70 TTCCCGGAAAACCAGGAGAAATGCACGGGCTGCAGGAAATGCGAGAGAATCTGCCCAACAAGATGTGTGAGG
Q50505_METTF/43-66 ACCCCATCAAATCTTGAATTCTGCCACCAGTGCATGATCTGCGCAAGTAAGTGTCCTGAGGGCGCCATAAGA
O27769_METTH/4-27 CTGGTTTCAAATCCAGAACTGTGCGATGAGTGCATGAAATGTGAGAGGATATGTCCAAAGAACGCCATCCGG
O27308_METTH/91-114 CCGGTACTGAACAGTGAAAAATGCGTTCACTGTTACTACTGTCACGACTTCTGCCCCCTCTACGCACTCTTC
Y1302_METJA/93-116 CCAAAAATTAATCCAGAAAAATGTGTATATTGCCTATATTGCCATGACTTCTGCCCAGTTTTTTCTGTGTTT
O26499_METTH/258-281 ATAACATGGAGCCCCGAAAAATGTGTGCAGTGCCGTTTATGCGTGGATGAATGCCCATCAGGAGCCATAACC
Q48941_METBA/102-125 CCGACGTCAGTAAACGAAAGCTGCGTCCACTGTGGGCTTTGTGAGGATATCTGTCCTCAAGGCTGTATTGAA
O58710_PYRHO/62-85 CCAAAGTTTAACTATTCCAAGTGCATAAAGTGCAGGAAGTGTGCTGAAGCTTGTGAGGAGCACGCGATAGTC
VORD_PYRHO/46-69 CCTGTTATTGATGAATCAAAGTGTGTTAAATGCTATATTTGCTGGAAATACTGTCCAGAGCCTGCTATTTAT
PORD_PYRFU/45-68 CCAGAGTTCAACAGGGACAAGTGTGTAAGGTGTTATCTCTGCTACATCTACTGTCCAGAGCCTGCAATATAC
PORD_METJA/27-50 CCAATTTTAGACAATGAAAAATGTGTAAAATGTGAAAATTGCTATATATTCTGTCCAGAGGGGGCTATTCAA
O26505_METTH/81-104 CCTGCAAGGATACTTGATAACTGTGTTAAATGTGAGATATGCGCCCAGACCTGCCCTGTGAGGTGCATAAAC
Y514_METJA/71-94 GCAAAGATAATTGAAGATAAATGTGTTAAATGTGAAATTTGTGCCCAAACATGCCCTGTTGGAGCAATATAT
O28573_ARCFU/29-52 CCTGTGGTTGACAAGGAAAAGTGCACAGCCTGCAAAACATGCGAGCAGTACTGCCCTGATCTGTGCATTGAG
P95902_SULSO/263-286 CCTACAGTAGATTTCGATACTTGTATCAAATGTAAACTATGTTGGGTGTACTGTCCAGATGAATGTTTCGAT
O67558_AQUAE/9-32 CCCATAGACCTTGCCGAGAAATGCGTAAAGTGCGGACTCTGTAAATCGGTGTGCCCCACTTACCCCTTCAAA
O59367_PYRHO/67-90 CCTATAGTTGATTACGAAAAGTGCATTGGCTGTTCTCTCTGTGTCCAAGTATGCCCCGGACTAGCGTTCTTC
FER3_PLEBO/68-91 ACGATCGCGAATCGCGATAAATGTATTGGTTGCGAAGCTTGTTCGCGGGTTTGTCCGAAGAACTGCTACACC
FER3_ANAVA/68-91 TCTATTATTCATCCAGAGTATTGTATTGGCTGTCAGGCTTGCGCTAGGGCTTGTCCGAAAAATTGTTACACC
FER3_RHISN/73-96 GTTGTCGATCACGCCGGCCGCTGCATCGGCTGCGGAGCCTGCGCCCGGGTATGCCCGAAGAACTGCCAGACC
Y264_METJA/18-41 GTTGTAGTAAATGTTGGGTCTTGCATTGGATGTAGGAGATGTGAAAGGAGTTGTCCAATAAATGGAATAACC
O28443_ARCFU/58-81 GAGGTAATCGATGCGGGACTTTGCTGCCACTGCGCTGCGTGCGCGTCAATCTGCCCGGTCAATGGAATAACA
Q9Z3W6_9RHIZ/132-155 CCCGTGCTCGACACCGATCCCTGCACCGGATGCGGCGCCTGCATTTCGGTCTGTCCCACCCAGTCCATCACC
Y1349_METJA/13-36 GAAGTTTGGGATACTAATAGATGTAGTGGTTGTGGAGCTTGTGTTGCAGTTTGTCCAGTAAATAACCTATAT
HYCF_ECOLI/33-56 CCAGAGCAGAACCCGCAGCAGTGCATCGGCTGCGCGGCCTGCGTCAATGCCTGCCCGTCAAACGCCTTAACG
HYFH_ECOLI/33-56 CCGGACCTGATGCCCAGCCAATGTATTGCCTGCGGTGCCTGCGCCTGTGCTTGTCCGGCAAATGCGCTGACT
O83022_RHOSH/128-151 CCGGACCTCTCGCCCAGCCTCTGCACCGGTTGCGGCGCCTGCCTCTCGGTCTGCCCGGTCGAGGCGCTGACG
YDHY_ECOLI/149-172 ATTACCGTCGATCATAAACGCTGTATTGGCTGTAGCGCCTGTACTACGGCATGCCCGTGGATGATGGCCACC
O83022_RHOSH/26-49 CGCGAGGCCGACATGGCCCGCTGCACGGGCTGCGCAGCCTGTACCGAGGCCTGTCCGGCAGGGATCGTGCGG
NIFJ_RHORU/689-712 TGTTCCTGGGACGCGGATCTGTGCATCCAGTGCAACAAATGCGTGATGGTCTGCCCACACGCCGCCCTGCGG
NIFJ_SYNY3/683-706 CCCGTTTGGGACCCCGATGTTTGTGTGCAATGCGGCAAATGCGTCATTGTTTGTCCCCATGCTGTGATTCGG
NIFJ_ANASP/701-724 CCTGTGTGGGATACAGATATCTGCGTACAGTGTAGTAAGTGTGTGATGGTTTGTCCCCATGCGGCAATTCGC
O83909_TREPA/689-712 CCCATTTGGGATCCGTCTGTTTGTATCCAGTGTGGTCAGTGCGCTATGGTGTGTCCTCACGCAGTTATCCGC
Q27088_TRIVA/675-698 CCAAAGTGGGAAGAAAAGAAGTGCATCCAGTGCAACACCTGCGCCATGGTCTGCCCACACGCTGTCATCCGC
Q24818_ENTHI/676-699 CCAACATGGGAAGCATCAAAATGTGTCCAATGTAATATGTGTTCACTTTATTGTCCACATGCTGCTATTAGA
NIFJ_ECOLI/682-705 CCCATCTGGAAAGAGGAACTCTGTACCCAATGTAACCACTGCGTTGCCGCTTGCCCACACTCAGCTATTCGC
NIFJ_KLEPN/684-707 CCGGTCTGGCAGCCGGAGGGCTGCACGCAGTGTAACCAGTGCGCCTTTATCTGCCCGCATGCGGCGATCCGC
P94692_DESAF/682-705 CCGCAGTGGGTCCCCGAGAACTGCATCCAGTGCAACCAGTGCGCCTTCGTCTGTCCGCACAGCGCCATCCTG
Q24982_GIALA/717-740 CCCATGTGGAAGAAGGAGAACTGCATCCAGTGCGGTTTCTGCTCTGTCCAGTGCCCGCACGCCGCCGTCCGC
O26866_METTH/334-357 CCGGAGTTCGATTATTCCCGCTGCATCAACTGTCTCTGCTGCATGGAGGTATGTCCACACGCAGCATTCTAT
O26501_METTH/80-103 CCCTACATAGACCCCTCCTACTGTGCAAGGTGCGAGGAATGCATGGACGTATGCCCCTCAGCAGCCATCAGG
O27242_METTH/65-88 CCCTCCTTTGATTTTTCAGCTTGCTCCATGTGTGGTAAATGTTCAGAGGTGTGCAGGAAAAATGCAATCGTA
RPOD_ARCFU/196-219 AGAGTTAAGAATGTTATGGCCTGCTCGATGTGCGGGGAGTGCGTAGAGGTCTGTGAGATGAACGCCATCAGC
Y934_METJA/65-88 TTTAGCTTTAGAGAAACCATATGCTCTGTTTGTGGAACTTGTGTTGATGTATGCCCAAACAACGCAATAATA
Y1303_METJA/103-126 AAAAAATTCCCAATGGGAATTTGCTCAATGTGTGGCGTCTGTGTTGAGGTTTGCCCTTACAATGCAAGAGTT
O33996_CHRVI/3-26 ACGTTCGTCTATATGACGCGCTGCGACGGTTGCGGCCAATGCGTCGACATCTGCCCGTCGGACATCATGCAC
Q55456_SYNY3/154-177 ACAGGAGTGTGGGCGGAAAAATGTTACGGTTGTGGCCGCTGTTTACCCATCTGTCCCCAGGGAATTATTACT
VHUB_METJA/66-89 GTTAATTATTTAGCTCATAAGTGTGAGAAATGTGGGCAGTGTGCTGAGGCTTGTCCTATTGGCATAAAAAAG
VHUB_METVO/56-79 TTAATCTACAACAGTAGTAAGTGTATAAAATGTGGAAACTGTGCAACTGCTTGTCCTACAGGCATTAAAAAA
Y934_METJA/92-115 TTTACCATAGATGCTGATAAATGCACAAAATGTGGAGTTTGTGTTTTATTTTGTCCAATACCTATAATAAAA
O58640_PYRHO/85-108 AGAATTGTCGATGATGATAAGTGCATTAGATGCAAGATGTGCACCCTCGTCTGCCCCATTGGCGGTGTCCTA
Y870_METJA/8-31 GAAATAGTCGATAGTGGAGTATGTGCAAGATGTGGGACCTGCACTATAGTATGTCCTAATGGTATATTAACC
O27309_METTH/58-81 TACGTTGTTGACAGGGCCAAGTGCAATGCCTGCGGTGTATGTGAGATGACCTGCCCTGTTAACAGTATAAAG
FER8_METJA/66-89 CCAATTGTAGATAAGGAGAGATGTATTGCTTGTGGAATGTGTGCAATTGCCTGCCCAATAGGAGCAATATTT
Y1303_METJA/73-96 TATTATGTAGATAGAAGGAGATGTAACGGTTGCGGTATATGTGCCAACGTCTGCCCAATTGGAATTATAAAG
O27178_METTH/27-50 ATAATCATAGATTATGATGAATGTGATGCATGTGGAGAATGTGTTGATGTATGCCCGATGGAGGTACTCATA
O93653_ARCPR/4-27 ATTAAAGTAGACCCAGAAAAGTGTGATGGATGTGGAGAGTGTATAGGTGTCTGCCCTGGAGAGGTATACGAG
O29822_ARCFU/4-27 ATAAACGTTGATCAGGACAAGTGCAGCGGATGTGGAGAGTGCATTTCCGTTTGCCCCGGAGGAGTGTTTGAG
Q9ZH19_DESTE/4-27 GTAACTGTTGACCGCGAAAAATGTGAGGGTTGTGGCGAGTGCGCGGATTCCTGCCCGGGCAGCGTTCTGGAA
Q50505_METTF/10-33 ATAATTGTTGATCCAGATAAGTGCACAGCATGTGGCGAGTGCCGGGAGGCATGCCCCAAGGGTGGTAAGATA
FER7_METJA/5-28 ATAATTGTAGATAGGGAGAAATGCATTGGATGTGGAAGATGTTATGATGTATGTCCAAAAGGGCCGTTAATA
FER_THEAC/61-84 GTTGCAGTTGACTGGGACTGCTGCATTGCAGATGGTGCATGCATGGATGTCTGCCCTGTCAATCTCTATGAG
FER_ENTHI/5-28 ACTATTGTTAACATTGATGACTGTGTCGCTTGCGGTGCCTGTTCTGGAACTTGCCCACAAAGTGTTCTTGAA
FWDF_METJA/269-292 TTAATAATCGATGTAAATGCATGTAACGCTTGTGGAGCCTGTATTTCCATATGTCCATGTAGTGCATTAGAA
O74028_METWO/264-287 CTCATAATCGACCAGGACACATGCCAGGCATGTGAAACCTGCGTGATGGTCTGCCCCTGCAACGTACTGTCA
MAUN_METEX/253-276 ACTTTGATCCTGTCAGGTGATTGTGTGAACTGCGGCAGCTGCATCGATGCCTGCCCTGTCAATGTCTTCGAG
FER2_METJA/75-98 ATAAAAAGGGATTTGGAGAAGTGTGTGCATTGTGGCTGTTGCATAACCCAATGCCCTATTAATGTAATTTAT
Y51B_METJA/124-147 CTTATAATTGACGAGGAAGTCTGTGTTAGATGTGGAAATTGCGAAAGAGCTTGCCCAATCAATGTAATTGAG
RPOD_ARCFU/166-189 GAAATTGTTGTTAACGAGAACTGCAACGGTTGTGGAGACTGCATCGAAGCCTGCCCGAGAAACGTTTTCGAG
O29252_ARCFU/2-25 GCAATAATCGTGCTGGAAACATGCAATGGATGCAAGGTATGCGAGGAAGTCTGCCCCTTCCACGTTTTTGAA
FER3_PLEBO/20-43 CAGTCAATCAATCAGACAAAATGCATTGGCTGTGGTCGATGCTTTAAAGCTTGTGGTCGGGATGTTTTAGCA
FER3_ANAVA/20-43 GAAGCAGTTAACCAAGATAAATGTATTGGTTGTGGTCGATGCTTTAAGGCTTGCGGCCGGAATGTGCTAATA
O15614_ENTHI/19-42 ATTCAATTTGATTGGTCTAAATGCATGGGTTGTGGAATGTGTGCTACTAAATGTACTTTGGGGGTGTTAGTA
FER_THEMA/3-26 GTAAGAGTTGACGCAGATGCCTGCATTGGATGTGGAGTTTGTGAGAATCTCTGTCCTGACGTTTTCCAGCTC
O30071_ARCFU/3-26 GCCGTTGTGGACAGAGACCTCTGCATTGGTTGCGGGACGTGTGAGGAAATATGCCCTGAGGTTTTCAGGCTT
FER2_DESVM/4-27 CTGTACCTTGATCAGGACGAATGCATGGCGTGCGAATCGTGCGTCGAACTTTGCCCCGAGGCGTTCAGAATG
O29780_ARCFU/4-27 GTTGTAGTTGACTTAAATCTCTGCAAGAAGTGCGGGATATGCAGTGAAATTTGTCCGAAGGGAGTTTTTGGT
O33163_METBA/211-234 CCGCAGGGTGACCTTAACCTCTGCATCAAGTGCGGCTCCTGCTATGGCGCCTGCCCAAGGTCGTTCTTCAAC
O27847_METTH/4-27 CTTGAACTGGATAGAACGATGTGCATATCATGCGGAAACTGCATTGACAGCTGCCCGGATCTATTTGAATTT
O26208_METTH/192-215 GCCGAGATAGATAAGACAAAGTGCATAATGTGCGGTTCATGCCTTGCAGCATGCCCGGTCCTCATACCAACC
O67147_AQUAE/136-159 GTGGACTTCGACCACTCCAAGTGCATAGGTTGTAAAATGTGCTTGGTGGGCTGTCCCTTTGATATTCCGAGG
FDNH_ECOLI/126-149 GTCGATTTCCAGTCGGAAAACTGCATCGGCTGTGGTTACTGCATTGCCGGGTGTCCGTTTAATATTCCGCGC
NIFJ_ECOLI/738-761 TTGCAGGTGGCACCGGAAGATTGCACCGGTTGTAACCTGTGCGTCGAAGTTTGCCCGGCGAAAGACCGTCAG
NIFJ_SYNY3/739-762 ATCCAGGTAGCCCCGGAAGATTGCACCGGTTGCGGCATCTGTGTGGACGTATGCCCGGCTAAAAATAAATCC
O83909_TREPA/745-768 ATTCAGGTTTCCCCAGAGGACTGCACAGGTTGTGGCCTGTGCGTGCAGCAATGTCCGGCAAAAAATAAGGCT
NIFJ_ENTAG/737-760 CTCGCCGTTTCTCCGCTCGATTGCTCCGGTTGCGGTAACTGTGCAGATGTCTGCCCGGTCAAAGGCAAGGCG
Q27088_TRIVA/727-750 ATCCAGATCACACCACTCGACTGCACAGGCTGCGCAACCTGCGTCACATCCTGCCCAACAAAGGCTCTCTCC
Q24860_ENTHI/735-758 ATTCAAGTTTCAGCTATGGATTGTACTGGATGTGAAGTATGTACTACTGCATGCCCAGTCAAATGTTTGAGT
Q24982_GIALA/780-803 GTCCAGGTTTCGCCGCTCGACTGCAGGGGATGCGGAGTCTGTGTAGAGGCCTGTCCCAAGGATGCCCTTGCC
Q48941_METBA/18-41 CTGATCTATTCCCCCGAAAAATGTATTGGCTGCGGGACCTGTGTGCAGGCATGCCCGAAAGGTAACCTGGCC
FER_ENTHI/34-57 GAAATTAAAAATCCAGATGATTGTATTGGATGTGGTGCTTGTGTTGATGCTTGCCCACAAGGAGTTCTTAAA
VHUB_METJA/336-359 ATTGAATTCAGCCCTTACTTATGTGATAAGTGTGGCAAATGTGTAGAAGTCTGCCCAATGAAGACATTAAGA
VHUB_METVO/341-364 ATTGAATTTAGCCCTGCTTTATGTAATGAATGTGGCGAATGTGTAGATGTATGTCCACAAGACACATTGAAA
VHCB_METVO/102-125 ATTGAATTTACACCGAGTCTCTGTGATAGTTGCGGTGCTTGTGTTGAAATCTGTCCACAAAACGTATTAAAA
MVHB_METTH/69-92 ATAGTCTTCAACCCTGACAAGTGTAACGAGTGCGGGGACTGTGTGGAGGTCTGCCCTCCACAGATCCTCAAA
MVHB_METFE/68-91 ATAACTTATAGTCCAGAAAAATGTGATAAATGTGGAGAATGTGTAAAAGTATGTCCACCTGGTATTCTAAAA
MVHB_METFE/358-381 ATACAGTACAATCCATCTTTATGTGATAAGTGTGGAAATTGTGTTGATGTTTGTCCTTATGGAATATTGAAG
MVHB_METTH/359-382 GTACAGTACAACCCTGCCCTCTGTGACCAGTGCGGTGACTGTATTGAGGCATGCCCATACGACATGCTGAAA
Y1303_METJA/288-311 CTATATTACAGCCCAGATGTTTGTTGGAAATGTATGGAATGCGTTAAAATCTGCCCTAACGATGTTAGAAGA
Q46508_DESFR/189-212 ATGAACCTGGCCGACACCGTGTGCACCAACTGCGGCCAGTGCGTGGCCGTGTGCCCCACCGGCGCCCTGGTC
O52683_THEMA/179-202 ACTCCCCTCATAGAGACGGAGTGTGTGCTCTGCGGACAGTGTGTAGCCTACTGTCCAACGGGAGCTCTGAGC
Q9ZBV9_STRCO/189-212 GGCCCGCTGACCGATTCCGCGTGCGTGTACTGCGGCAACTGCATCGAGGTGTGCCCCACGGGCGCCCTGTCC
Q59262_CLOAB/182-205 GTTTGTCTTGATGACTCAACATGCTTATTATGCGGTCAGTGTGTAATCGCTTGTCCTGTTGCTGCTTTAAAA
Q9ZNE4_CLOPE/183-206 AAATGTTTCGACGATACAAATTGTTTATTATGTGGACAATGTATAGCTGCTTGCCCAGTTGATGCATTATCA
O66748_AQUAE/189-212 AGACCTATGGACACATCTACGTGTGAAATGTGCGGTATATGCGTGCACGTTTGCCCCGTAGGCGCTATTATT
Q46606_9DELT/188-211 CGTAGCCAGAGTGCGTCCGACTGTGTGGGCTGTGGCCAGTGCACATTGGTCTGCCCTGTGGGGGCATTGGCT
Q50743_METTF/186-209 AGGGATATACTTGATTCAAGCTGCGTCTCATGCGGTGAATGCGTCGAGGCATGCCCGGTGGGCGCCCTCCTA
O27595_METTH/167-190 AGGGCCATCACTGAATCGAGCTGTGTATCCTGCGGGGAATGTGTGGAGGTCTGCCCTGTGGGGGCCCTTGTT
O05397_BACSU/191-214 GTTCCGATCAATGAATCTTCCTGTGTCAGCTGCGGTCAGTGTGTAACAGTATGTCCATGTAATGCACTGATG
O87815_ALCEU/209-232 CAGTCGTTCATGGAATCGGACTGCGTCTCGTGCGGCGCCTGCGTGCAGGCGTGCCCGACCGCGACGCTGACC
O29082_ARCFU/105-128 GTAGCGATAAACACGGAGAAGTGCGTTCACTGCGGCTCGTGCGTGAAGGTCTGCCCGACGAGGGCTCTCAGC
P77908_MOOTH/185-208 GTAAGCCTGGAAGAAGGGGGCTGCGTCTTTTGCGGTAACTGTGTCCAGGTCTGCCCGGTGGGAGCTCTGACG
O59110_PYRHO/70-93 GTTGCCCTATGGACTGGAAGATGCGTATTCTGCAAGCAATGTGTTGATGTTTGTCCAACGGGTGCATTGCAG
O59116_PYRHO/93-116 CCAAAGATCGACTATGGAAGATGTACCTTCTGTCAATTCTGTGTTGACGTCTGTCCCACAGGGGCCCTTGGG
O27009_METTH/283-306 GCCCGGATCGATGAGAAATTCTGCGTATTCTGCGGAGCATGCTCCAGTGTCTGTCCCGATGGACTCCTCTCT
O15614_ENTHI/69-92 GTACTTATTGATGAGTCTGAATGTACTGGGTGTGGTCAATGTTCTTTGGTTTGTTATTTTGGTTCTCTTACA
FERA_METJA/31-54 ATAGTTATTGATGAAAAAAAGTGTAATAACTGTAAGTTATGCACAATAGTATGTCCATTAAATGCATTAGAG
P73811_SYNY3/77-100 ATTGTCATTGATGACCAAAGTTGTGTAGATTGTGGCCTCTGTACCGGGGTTTGCCCTACGGAGGCTCTGAGT
Y51B_METJA/80-103 CCAGTGATTGATGAAGGTTCTTGTGTAGCATGTGCCAACTGTATTGAAGTTTGTCCAACAGGAGTTTTAGAG
Q44513_ANAVA/185-208 CCTTGGGGAACTTCCGACACTTGTACTTCCTGCGGTAAATGCGTCAATGCTTGCCCCACAGGAGCTATATTT
P94157_SYNP6/185-208 CCTTGGGGCGCAGTCGATGCCTGCACCAACTGCGGCAAATGTATCGATGCCTGCCCGACCGGAGCGCTGTTC
P97030_BACSU/230-253 GATGTGCCGATTGAAGATATGTGCGGGTCCTGCACGAAATGCTTGGACGCCTGCCCAACGGGAGCACTGGTT
YGL5_BACST/20-43 GACAGCCCCATTGAAGACCGATGCGGATCCTGCAACATATGTGTCGATTCATGTCCGACTGGTGCGCTCGTA
VHUB_METJA/299-322 GAGAAGAAGGAAGTAAGAATGTGTATCGTCTGTGGAGCTTGTACTGTAGCCTGTCCAACAGGAGCTTTAAAG
VHUB_METVO/304-327 AAAGACCCAGAATTTAGAATGTGTATCAGATGTGGTGCTTGTGTTATGAAGTGTCCAACTGGTGCTTTAAAA
MVHB_METTH/318-341 GAGGAACCATCCTTTGCCATGTGTACCCGCTGCGGTGCATGTACGGTGGCCTGTCCTAAGGGCGCACTGAGC
MVHB_METFE/317-340 GAAAAGGAATCATATACTATTTGTACAACTTGTGGTGCATGTACAACAGTGTGTCCAACAGGAGCATTAAAA
YDHY_ECOLI/176-199 GAAAGTAAAAAATCCTCGAAATGTGTGTTATGCGGTGAATGCGCAAACGCCTGCCCAACAGGGGCGTTAAAA
Q48941_METBA/59-82 GAAATGAAAGAACGTGAAGCCTGCCTTGTCTGTGGAATTTGTGCGAAAGCTTGTCCCACAGGTGCTCTTGAA
VHCB_METVO/65-88 AGAGCAAACGAATTTAAAATGTGCGATTTATGTGGAACGTGCGTATCTGCATGCCCAACAGAAGCTTTGCAA
O26840_METTH/199-222 CTGAAAAGGGAGGAGTCCAGCTGTGTTCTATGCGGTCGCTGTGAGGAGGCCTGCTTCACTGGTGCCATAGCT
MAUM_PARDE/57-80 GAACAGGACTTCCTGGCCGCCTGCGTGCATTGCGGGCTATGCGTGCAGGCCTGTCCCTACGGCACGCTGTCG
MAUM_METEX/53-76 GAAGACGACTTTCTAGCAGCCTGCGTGCGCTGCGGCCTGTGCGTGCGCGCCTGTCCCTACGATACCCTGCGG
NAPG_ECOLI/54-77 GAGAACGCCTTTGCCAGTGCCTGTGTGCGTTGCGGTCAGTGTGTTCAGGCTTGCCCTTACGACACCTTAAAA
NAPG_HAEIN/65-88 GCGAAAGCGTTTTCTGCCGCTTGTATTCGTTGCGGACAATGTGTTCAAGCCTGTCCTTATGACATGCTGCAT
MAUM_METFL/64-87 GAAAAAGATTTCCAATCGGCTTGCGTGCGTTGCGGCCTATGTGTGGAAGATTGCCCGTTCGACATCCTCAAG
MAUM_METME/61-83 CCAGAGTTCAATGCCGCC---TGTATCCGCTGTGGCTTGTGCGTAGAAGCTTGCCCCTTAGATATTTTGCAC
O67386_AQUAE/121-144 TTTAACATGAACATGCTCCTCTGCACTTATTGCGGTTTTTGCGTGGACGCATGCCCTGTGGATTGCCTTTAT
O67337_AQUAE/120-143 TTTGACATGAACCTCCTTAACTGTCTCTTCTGTGGGCTCTGCGTTGACGCGTGTCCCGTGGGATGTCTTACG
Y1043_HAEIN/46-69 GAAGATTTATTTTCCGCCGTCTGCAATGGTTGTGGGGAATGCGCTTCAGCTTGTCCTAATGGTTTAATTCAA
YJJW_ECOLI/40-63 AATCCGTGGACGATGGGACGTTGCAATGACTGTGGGGAGTGCGTGCCACAGTGTCCGCATCAGGCGTTGCAG
FRDB_MYCTU/142-165 GCATTCAAGCAGTTCAGCATGTGTATCAACTGCATGTTGTGCTACTCGGCGTGCCCGGTGTACGCGCTGGAC
Y1303_METJA/259-282 ACATCCCAACCAACAAGTTATTGTATAAATTGTGGGTTGTGTGCTGAACACTGCCCAAGTGGAGCTTTAAGG
O29575_ARCFU/135-158 GAGTACTACGTCTTCACACTCTGCATCAAGTGCGGAGCCTGCTACTCGGTCTGCCCAGCAGCAGCAACTCTT
O29595_ARCFU/529-552 CCGCAGTTCTTCCTCCAGCGCTGCACTCAGTGTAAGAGGTGTACTGAAGAGTGCCCCTTTGGTGCACTTGAT
PSAC_EUGGR/40-63 TCTTCTCCAAGAACCGAAGATTGTGTAGGATGTAAAAGATGCGAATCTGCATGTCCTACTGATTTCCTAAGC
O29595_ARCFU/559-582 CCGATGCCCAATCCGCTGAGGTGCAGGAGATGTGGTATCTGCTTCGGTGCCTGTCCTGAGAGAATCATCAGC
O26380_METTH/587-610 TCCTACACCAGCTATGACCTCTGTGTGGGCTGCGGGAAGTGCATAAAATCATGTCCGCACAGCGCAAGGGAG
Y870_METJA/517-540 TCTTACACAAATTACAACGTATGTGTTGGCTGCGGAAAATGTATTAAAAACTGTCCAAATGAGGCAAGGGAA
O30290_ARCFU/84-107 GCCTATCCTCTGCCGGAGCTGTGCCACAGCTGCGGAGCATGCATCTACCTCTGCCCGGAAAAGGCGATGGAG
O26323_METTH/189-212 CATTCATGGATCCCTGAGTACTGTGCAAGGTGCGGTAAATGCATAAAGGCCTGTCCTGAGGATGCCCTGGTG
O26378_METTH/32-55 CTCAAATTCAGAGAGGATGAGTGCAGGGAATGCAACATATGCATACAGGTGTGCCCGGTCAGGGCCCTTGAG
P73811_SYNY3/108-131 TTGATGTTCCGTCGTTCCCGTTGTGTGGTCTGTGAGCAATGTATTCCTTCCTGCCCCGTCCAGGCGATCGCC
O58006_PYRHO/570-593 TTATTAAAAAGGGCTTATGAGTGTGTTGGGTGTGGGGTGTGCATCACAAGCTGTCCGGAAGAAGCTATAGAG
MVHB_METTH/387-410 AAGGTTCCACTTAAAGGGTTCTGCATACTCTGTGACCAGTGCATACCTGCCTGTCCTAAGGGTGCACTGTCA
VHUB_METJA/94-117 TTCCCTTACTCAAAGGGGCATTGTGTCCTCTGTCAAAAGTGTATTGACGTGTGTCCAATAGAGATCATTTCA
DSVB_DESVH/250-273 ATCGCCATCAAGAACGAACGCTGCATGTACTGCGGTAACTGCTACACCATGTGCCCCGCGCTGCCCATCTCC
Q9ZH17_DESTE/251-274 CTCAAGATTAAAGTGGAGCGCTGCATGTTCTGCGGCAACTGCTACACCATGTGCCCGGCCCTGCCCATTGCC
O93651_ARCPR/241-264 GTAATACTCGACAAGGACAAGTGCATGTACTGTGGAAACTGTTACACAATGTGTCCGGGTATGCCAATCTTC
DSRB_ARCFU/234-257 ATCAAGGTTGACGTGGAGAAGTGCATGTACTGCGGTAACTGCTACACGATGTGCCCCGGCATGCCACTCTTC
FDHB_METFO/341-364 ATGTTACACATGGTGGAATCCTGTACCAACTGTGGTCAGTGCGAAGAAGTCTGTCCTGGTGAAATACCACTA
FDHB_METJA/323-346 TTGAGCCATATATCCCAAAGTTGTATAAACTGTGGGCAGTGTGAAGATGCATGCCCAATGGATATTCCTTTA
O24950_HELPY/357-380 TACGGGCATATCCCTAATTTGTGCAGTCTTTGCGGGCGTTGCACTGAAGTATGCCCCGTAGAAATCCCTTTA
RNFC_ECOLI/409-432 ACCACGCATAACATTGCTGATTGCATTGAATGTGGGGCTTGCGCGTGGGTTTGCCCGAGCAATATTCCCCTG
YCCM_ECOLI/244-267 ATTCGTCGCAATGCCGAAAGTTGTATCGACTGTGGCAAATGCGCAAAAAATTGCCCATCACGGATCCCGGTC
ACDA2_ARCFU/436-459 CTGGAGAAGGAGTGGGATGTTTGCATTGCATGCGGAAGGTGTGAACAGGTCTGTCCAAAGGGCATTCCGATC
NUIC_ORYSA/55-78 ATCCACTTTGAATTTGATAAATGTATTGCTTGTGAAGTATGTGTTCGCGTATGCCCTATAGATCTACCTCTT
P73649_SYNY3/39-62 TACTGGATTGACTTTGCCACCTGCATCGATTGCGGCATCTGCCTCCAAGTTTGCCCGGTGGAAGGGGCCATT
Y51B_METJA/153-176 TATGTAATAAATATGGCTTTATGTATTTCTTGTAAAGAATGTATCAAAGTTTGTCCTATAGAGAATGCAATA
Y1303_METJA/444-467 ATTAGAACTGATATGGACTTCTGTATAAAGTGTGGTCTCTGCAACAAGGTCTGCCCAAATAATTGCATTGAT
O58711_PYRHO/67-90 GCTAGGATAAACCCAGAGAGTTGTATAAGGTGTGGCCTTTGCCAAATGAGGTGCCCCTACGAATGCATATAC
Q59262_CLOAB/139-162 ATTGTAATTGACAGATCAAAATGTGTACTATGCGGTAGATGCGTAGCTGCATGTAAACAGCACACAAGCACT
Q9ZNE4_CLOPE/140-163 ATAGTTTTAGATAGAAGTAAATGTGTTAAATGTGGTAGATGTGTTGCGGCATGCAGAACAAGAACTGCTACT
PHF1_CLOPA/140-163 TTAACTGTAGATAGGACAAAATGCTTATTATGTGGAAGATGTGTTAATGCCTGTGGAAAAAATACTGAAACC
Y1303_METJA/174-197 ATTAAAATTGATAGAGATAAATGCGTTGGATGCTTAAGATGCTCTTATTTATGTCCAAGAGATACTATAGTC
O26295_METTH/206-229 GATGTGATAGATGTGGGGGCCTGCGTCCTCTGCGGGGCCTGCGTGGCCTCATGCCCGGAGGACATAGTCAGC
O26499_METTH/80-103 CCTGTCATAGTCAGGGGTGCGTGCATCAGGTGCGGCTTCTGCGCCGAGGTCTGCCCCACCGACCCCAAGACA
O34720_BACSU/141-164 TATCGGTATGATCCAGATCAATGTATATTGTGCGGACGCTGTGTTGAGGCATGCCAAGACGTTCAGGTAACT
O05397_BACSU/148-171 TACCGCTATGATCCAAACCAATGTATTGCCTGCGGCCAGTGTGTTGAGGTCTGTCAAAACCTTCAGGTAAAT
P77908_MOOTH/139-162 ATTGTGCGGGATTATAATAAATGTATCGTTTGCGGCCGTTGCGTCCGCGCCTGCCAGGAGGTGCAGGTCCAG
Q46507_DESFR/465-488 CACACCATCGATACCACACGGTGCATCAAGTGCGGCGCCTGCTACGACAAGTGCAAGTTCGACTCCATCATC
O27592_METTH/586-609 CATGTTATAGACCAGGATGGGTGCCTCAAGTGCGGGTCCTGTCTTGATATATGTAAGAGGGATGCTGTCAGG
Y578_METJA/69-92 ATATATGAGATAAATGATGACTGCATAAGATGTGGAAAATGCTTAGATGTCTGTCAATTTGACGCTATAGGG
O30289_ARCFU/60-83 GCAAGGATAATGCCGGAAAAGTGCTCCTCATGCGGCTTGTGCTATGACCTCTGCAGGTTTGGGGCGGTTGTG
O29112_ARCFU/222-245 TACCAGATTAACAGGGAGAAGTGCGTCAAGTGCCTCGGCTGCTCGGAGGCCTGTGATTATGGGGCTGTTAAA
HDRA_METTM/293-316 GCAACAATTGACAAGGACTACTGTATAGAGTGCATGCTCTGTGATGAGGTCTGTGAAAGGGGAGCCGTTAAA
O29030_ARCFU/284-307 GCTGCAATAGACTGGGAGCATTGCATAGGCTGCAGACTCTGTGAGAAGGCCTGCCAGCCAAAGGCTGTGGAC
Y749_METJA/187-210 CTGAAACTTGATGAAAATAAATGTGTAGGTTGTAGATTGTGTGAAAGAAAATGTCCAATGCAGATAAAAATA
O27854_METTH/216-239 GTTAAGATAGAATATGATGAGTGCATAGCCTGTATGAACTGTATGGACAGCTGTCCAAATGAGGTTTATGAT
VORC_METTH/6-29 CCTGTAATAAACAGTGTGGAGTGCAAGGCATGTGAACGCTGCATAATCGCATGCCCCAGGAAGGTCCTCCAG
FER5_METJA/82-105 CCCAAAATTGATTATAATAGATGCAAAAATTGTGAAAAATGTATCTCTTTTTGTCCAAGAGGAGTTTATGAT
FER1_METJA/23-46 ATTGAGATTGATTATAACAAATGTAAAAACTGTTTATCATGTTATAGAGTCTGTAAAAATAACGTTTTTGCT