C57BL/6 mice (8–10 weeks old, male) were purchased from Shanghai Super-B&K Laboratory Animal Corp., Ltd. (Shanghai, China). CB2R knockout (KO) mice on C57BL/6 background (8–10 weeks old, male) were purchased from Jackson Laboratory (Bar Harbor, MA) (B6.129P2-Cnr2^tm1Dgen/J, Stock Number: 005786) and kept at 22°C under a 12-h light/dark cycle with unlimited access to water and standard rodent diet. All experiments were approved and conducted in accordance with the guidelines of the Animal Care Committee of Second Military Medical University.

Mice peritoneal macrophages were collected as described previously [15–17]. In brief, CB2R KO mice and age- and sex-matched WT controls were injected 10% thioglycollate (i.p.) for 3 days. Resident peritoneal macrophages were collected from the peritoneal cavity by flushing with 5 mL of ice-cold Hanks’ balanced salt solution containing 10 U/mL heparin. Macrophages were plated at a density of 5×10⁴/mL in Dulbecco’s modified essential medium supplemented with 10% fetal calf serum, and were left to adhere for 4 hours in a humidified atmosphere at 37°C with 5% CO₂. Then cells were washed twice, and the remaining cells were primed with 10 ng/ml lipopolysaccharides (LPS, Sigma, Louis, MO, USA) for 1 h, and then were stimulated with 3% DSS (mol. wt. 36,000 to 50,000 kDa, MP Biomedicals LLC, Santa Ana, CA, USA) in the presence or absence of 10 μM HU 308 (TOCRIS Bioscience, Bristol, BS, UK) for 24 h [18,19]. In another set of experiments, peritoneal macrophages from WT and CB2R KO mice were stimulated with/without LPS/DSS for 24 h.

The following siRNAs against Atg5 (Gene ID: 11793) were synthesized by Genepharm Biotech (Shanghai, China): siRNA1, 5’-CUCUCUAUCAGGAUGAUTT-3’, 5’-AUCUCAUCCUGAUAGAGAGTT-3’; siRNA2, 5’-GACGUUGGUAACUGACAAATT-3’, 5’-UUUGUCAGUUACCAACGUCTT-3’; siRNA3, 5’-GCGGUUGAGGCUCACUUUATT-3’, 5’-UAAAGUGAGCCUCAACCGCTT-3’; siRNA4, 5’-GCUACCCAGAUAACUUUCUTT-3’, 5’-AGAAAGUUAUCUGGGUAGCTT-3’. All siRNAs consisted of 21 nucleotides and contained symmetric 3’ overhangs of two deoxythymidines. Mice peritoneal macrophages were transfected with siRNAs as previously reported [20,21].

Proteins were extracted from the tissue or cultured cells using a standard extraction reagent supplemented with the protease inhibitor (KANGCHEN; Shanghai, China). The protein concentration was determined using a BCA protein assay kit (Beyotime Institute of Biotechnology; Haimen, China). The proteins were separated using SDS PAGE and electro-transferred to nitrocellulose membranes as described previously [22,23], and incubated with a primary antibody for 8–12 h at 4°C. Samples were then incubated with an IRDye800CW-conjugated secondary antibody (Rockland; Gilbertsville, PA, USA) for 1h at 25°C. The image was acquired with the Odyssey infrared imaging system (Li-Cor Bioscience; Lincoln, NE, USA). All immunoblotting experiments were repeated for at least 3 times.

The relative mRNA expression of IL-1β was determined by quantitative real-time polymerase chain reaction using the ABI PRISM 7700 Sequence Detection System based on published methods with optimal concentrations of primers and probes. Mouse IL-1β primer (forward: 5’-CTCGTGCTGTCGGACCCCAT-3’ and reverse, 5’- AGTGTTCGTCTCGTGTTCGGAC -3’) was added at a final concentration of 900 nM. For internal controls, mouse GAPDH primers (forward: 5’-GTATGACTCCACTCACGGCAAA-3’ and reverse, 5’-GGTCTCGCTCCTGGAAGATG-3’) were added at final concentrations of 500 nM, respectively. The thermal cycler conditions were 35 cycles of 94°C for 20 seconds, 55°C for 20 seconds, and 72°C for 30 seconds. Data were analyzed using Sequence Detection System software version 1.9.1. All samples were run in duplicate.

The level of IL-1β, IL-6 and TNF-α in cell supernatants were quantified using commercial ELISA kits (R&D system, New York, NY, USA).

RAW 264.7 cells (murine macrophage from blood) were incubated overnight at 37°C on glass coverslips, followed by the treatments mentioned above. Cells were fixed in 200 μl of 4% paraformaldehyde for 15 min, washed with phosphate-buffered saline (PBS) before blocking with 5% bovine serum albumin in PBST, and incubated with primary antibodies overnight at 4°C. Double immunofluorescent staining was completed by Alexa-488 or Alexa-647-labeled secondary antibody (Invitrogen, USA) incubation for 1 h at room temperature. After being washed, slides were mounted with Vectashield mounting medium containing DAPI (Vector Laboratories, Burlingame, CA, USA) and colocalization was observed using a confocal laser scanning microscope (Fluoview FV1000; Olympus, Tokyo, Japan). Image Pro Plus 6.0 software (Media Cybernetics, Bethesda, MD, USA) was employed to analyze colocalization, expressed as the Pearson correlation coefficient as previously reported [24,25].

Colitis was induced in C57BL/6 wild type (WT) and CB2R KO mice with 3% DSS dissolved in drinking water given ad libitum (days 1–8) as previously described [26,27]. Body weight and bloody stool were monitored once a day until day 8. Changes of body weight are indicated as loss of baseline body weight as a percentage. Then mice were anesthetized with phenobarbital sodium (60 mg/kg, i.p.) and euthanized by cervical dislocation. Postmortem, the colon was removed and pieces of colonic tissue were used for ex vivo analysis. The presence of occult or gross blood per rectum, and stool consistency were determined by two investigators blinded to the treatment groups. A scoring system was used to assess diarrhea and the presence of occult or overt blood in the stool [28,29]. For histology, rings of the transverse part of the colon were fixed in 4% buffered formalin and embedded in paraffin. Sections were stained with H&E according to standard protocols. Histological scoring was performed in a blinded way by a pathologist. Focally increased numbers of inflammatory cells in the lamina propria were scored as 1, confluence of inflammatory cells extending into the submucosa as 2 and transmural extension of the infiltrate as 3. For tissue damage, discrete lymphoepithelial lesions were scored as 1, mucosal erosions as 2, and extensive mucosal damage and/or extension through deeper structures of the bowel wall as 3. The two equally weighted subscores (cell infiltration and tissue damage) were added and the combined histological colitis severity score ranged from 0 to 6. During the experimental procedure, euthanasia is performed prior to the experimental endpoint if there were rectal prolapse, loss of over 15% body weight, or signs of pain and distress such as poor grooming, decreased activity, and hunched posture.

Data are expressed as means ± SEM. For nonparametric data, a Kruskal-Wallis test followed by a Dunn’s post-test was used. For continuous variables, the statistical differences between groups were determined by one-way analysis of variance followed by a Student-Newman-Keuls test. Statistical analyses were performed using GraphPad Prism 4 software (GraphPad Software, San Diego, CA, USA). P < 0.05 was considered statistically significant.

LPS/DSS stimulation increased the protein abundance of NLRP3, Casp-1 p20/Casp-1 p45 ratio, proIL-1β and the mRNA of IL-1β in C57BL/6 mice peritoneal macrophages. Pre-incubation with HU 308 significantly attenuated the increase of protein abundance of NLRP3, Casp-1 p20/Casp-1 p45 ratio, proIL-1β and IL-1β mRNA in macrophages induced by LPS/DSS (Fig 1A and 1B). After LPS/DSS challenge, the protein abundance of NLRP3, Casp-1 p20/Casp-1 p45 ratio, proIL-1β and the IL-1β mRNA were increased significantly more in CB2R KO than in WT peritoneal macrophages (Fig 1C and 1D). Moreover, LPS/DSS stimulation increased IL-1β, IL-6 and TNF-α in supernatant. Pre-incubation with HU 308 significantly decreased IL-1β but not IL-6 and TNF-α in the supernatant of the cultured C57BL/6 mice peritoneal macrophages challenged with LPS/DSS (Fig 2A–2C). In comparison with WT peritoneal macrophages, CB2R KO ones secreted more IL-1β but unchanged IL-6 and TNF-α upon LPS/DSS stimulation (Fig 2D–2F).

Upon LPS/DSS stimulation, LC3-II/LC3-I ratio and Beclin-1 abundance were increased and SQSTM1 (a selective substrate of autophagy) abundance was decreased in C57BL/6 mice peritoneal macrophages. Pre-incubation with HU 308 further enhanced the effects of LPS/DSS on the LC3-II/LC3-I ratio, Beclin-1 and SQSTM1 (Fig 3A). When compared with WT peritoneal macrophages, LC3-II/LC3-I ratio and Beclin-1 abundance were decreased and SQSTM1 abundance was increased in CB2R KO groups upon LPS/DSS challenge (Fig 3B).

LPS/DSS stimulation induced the colocalization of NLRP3 with apoptosis-associated speck-like protein containing a CARD (ASC) and NLRP3 with Casp-1 in RAW264.7 cells, which was partially prevented by pre-incubation with HU 308. Blocking autophagy by Atg5 siRNA attenuated the inhibitory effect of HU 308 on the colocalization of NLRP3 with ASC and NLRP3 with Casp-1 (Fig 4A–4E). Moreover, HU 308 also decreased the Casp-1 p20/Casp-1 p45 ratio and IL-1β secretion in RAW264.7 cells stimulated with LPS/DSS. This effect of HU 308 was attenuated by Atg5 siRNA (Fig 4F and 4G).

After drinking 3% DSS water for 8 days, mice developed a severe illness characterized by the presence of sustained weight loss, bloody diarrhea, and severe colon inflammation associated with hyperemia, ulceration and bowel wall thickening leading to an increase of colon length reduction. During this process, one of 10 mice in CB2R KO group died of exacerbated colonic inflammation and exited experiment prior to the experimental endpoint. Our results showed that treatment with HU 308 (1 mg/kg, i.p.) significantly improved symptoms of weight loss, bloody diarrhea, colon length, and colon inflammation, with alleviated inflammatory infiltration in mucosa and submucosa in DSS-induced colitis mice (Fig 5A–5E). In comparison to WT mice, DSS induced a more severe illness and aggravated inflammatory infiltration in colon wall in CB2R KO mice (Fig 5F–5J).

Compared with the vehicle group, treatment with HU 308 (1 mg/kg, i.p.) significantly decreased NLRP3, the Casp-1 p20/Casp-1 p45 ratio and proIL-1β in colon from DSS-induced colitis mice. When compared with WT mice, DSS induced a further increase of NLRP3, Casp-1 p20/Casp-1 p45 ratio and proIL-1β in colon from CB2R KO mice (Fig 6A and 6B). In addition, treatment with HU 308 also significantly increased the LC3-II/LC3-I ratio and Beclin-1 and decreased SQSTM1 in colon from DSS-induced colitis mice. In comparison with WT mice, DSS induced decrease of LC3-II/LC3-I ratio and Beclin-1 and an increase of SQSTM1 in colon from CB2R KO mice (Fig 6C and 6D).

In DSS-induced colitis mice, treatment with 3-MA (10mg/kg, i.p.) attenuated the beneficial effects of HU 308 on weight loss, bloody diarrhea, colon length and colon inflammation, with relatively aggravated inflammatory infiltration in mucosa and submucosa in DSS-induced colitis mice (Fig 7A–7E). Furthermore, 3-MA also attenuated the inhibitory effect of HU 308 on Casp-1 p20/Casp-1 p45 ratio and proIL-1β in colon from DSS-induced colitis mice (Fig 7F).

In colon from DSS-induced colitis mice, the level of p-AMPK was decreased and the level of p-mTOR and p-P70S6K were increased in CB2R KO group when compared with those in WT group (Fig 8A). In WT peritoneal macrophages treated with LPS/DSS, HU 308 stimulation increased the level of p-AMPK and decreased the level of p-mTOR and p-P70S6K. However, in CB2R KO peritoneal macrophages challenged with LPS/DSS, HU 308 stimulation did not affect the levels of p-AMPK, p-mTOR and p-P70S6K (Fig 8B). Furthermore, pre-treatment of the peritoneal macrophage with Compound C (an inhibitor of AMPK) before LPS/DSS stimulation and HU 308 incubation partly blocked the inhibitory effects of HU 308 on the expression of NLRP3, proIL-1β and Casp-1 p20/Casp-1 p45 ratio (Fig 8C).