The first fragment of a nic gene cluster (here designated as nic2) catalyzing the late steps of nicotine degradation was identified using in silico analysis of the P. putida S16 genome sequence, the nic gene cluster in KT2440, and the gene sequence of HspB. The entire 5.8-kb nic2 gene cluster was cloned into pMD18T. Resting cells of E. coli DH5α containing the pMD18T-nic2 construct degraded HSP completely within 9 h at 30°C and 37°C temperatures (data not shown). Fig. 1B shows the chromosomal nic2 gene cluster consisting of 6 open reading frames (ORFs). No sequences could be found by BLAST search, using the S16-nic cluster (hspB-ami part, 5,763 bp, GC content 47.9%) and nic cluster (iso-ami part, 3,233 bp, GC content 48.0%). The G+C content of the S16-nic2 cluster (47.9%) is considerably lower than the average for the P. putida S16 genome (62.3%). The 4 downstream enzymes catalyze steps 6-9 of the pathway (DHP to fumaric acid) (Fig. 1), and have orthologs in other bacteria, some of which are known to degrade nicotinic acid but not nicotine (Fig. 1B). The similarities among these orthologs are as low as 33% (indicated by the fading colors of the ORFs in Fig. 1). The dark cyan arrow indicates a nicotinic acid monooxygenase (6-hydroxy-nicotinate 3-monooxygenase, Hna), which has no ortholog in P. putida S16. The enzymatic activities of all four proteins of P. putida S16 have been verified. The presumptive ATG start codon was detected in nfo, hpo, and ami, whereas the rare initiation codon GTG was found for iso. The Shine-Dalgarno sequences¹⁹ were identified in the upstream regions of the putative start codon of hpo ('GAGAGGCGCGATATG'), and that of ami ('AAGGAGTATTATATG')¹⁹. The 4 genes are tightly linked, with no bases between the termination of iso and the start of nfo, 12 bases between the termination of nfo and the start of hpo, and 38 bases between the termination of hpo and the start of ami. Non-quantitative reverse transcription polymerase chain reaction (RT-PCR) showed that the 4 genes appeared to be upregulated in 6 mM nicotine or 1 mM DHP addition separately, whereas no significant effects in the 4 genes expressions were observed with the individual addition of 1 mM NFM, 6 mM maleamic acid, or 6 mM maleic acid (Fig. S2A and Fig. S2B).

These enzymes were colorless, indicating that no tightly associated chromophores were present.

Hpo—The hpo gene was cloned from the gene cluster and over-expressed in E. coli BL21(DE3). Hpo was purified and showed an apparent molecular mass of 40 kDa which corresponds to the predicted gene product weight (Fig. 2A). The effect of pH on the spectrophotometric assay is shown in Fig. 2B. Optimum pH was 6.5 in phosphate buffer. The optimum temperature for the enzymatic reaction was approximately 20°C and was identified by measuring the initial reaction velocity for 1 min (Fig. 2C). Among the 10 metal salts tested, only Fe²⁺ (0.025 mM) showed markedly increased enzyme activity (Fig. 2D). The double reciprocal plots of initial velocity against DHP concentration were straight lines, indicating that Michaelis-Menten saturation kinetics were characteristic of the substrate. The calculated apparent K_m for DHP was 0.168 μM, V_max was 7.0 U mg⁻¹, and k_cat was 11.0 s⁻¹. The product of the enzymatic reaction, N-formylmaleamate (NFM), was also detected by the API 4000 liquid chromatography-mass spectrometry (LC-MS) system (Applied Biosystems, Foster City, CA). A molecular ion at an m/z value of 112.2 corresponds to DHP according to positive mass spectrometry. Additionally, negative mass spectrometry experiments revealed an (M-H)^- peak at m/z 142.1, corresponding to NFM, which is in agreement with that reported by Jimenez¹⁸ (Fig. S3).

Nfo, Ami, and Iso—The 29 kDa protein Nfo is consistent with the predicted product of the nfo gene (Fig. 3A). Because NFM was not commercially available, it was chemically synthesized, and the product was confirmed by ¹H nuclear magnetic resonance (NMR) (Fig. S4). The signals were assigned to the corresponding protons as indicated in the box (Fig. S4). Nfo activity was measured through its production of formate by a coupled reaction with nicotinamide adenine dinucleotide (NAD)-dependent formate dehydrogenase (Fdh) (Fig. 3B). Purified Ami (Fig. 3A) transformed maleamic acid to maleic acid with the production of NH₄⁺ (not shown). NH₄⁺ concentration was monitored by a decrease in the amount of nicotinamide adenine dinucleotide phosphate (NADPH) measured at 340 nm in a reaction buffer containing glutamate dehydrogenase (Gdh) (Fig. 3C). Iso was also expressed in E. coli BL21(DE3)/pET28a-iso, and the 28-kDa enzyme was purified (Fig. 3D). Iso is similar to an isomerase from Ralstonia eutropha H16 (71% amino acid sequence homology), and to the Asp/Glu racemase of Serratia proteamaculans 568 (72% amino acid sequence homology). Iso activity was determined by high-performance liquid chromatography (HPLC) (Agilent 1200 series, Hewlett-Packard Corp., Santa Clara, CA, USA) analysis in the presence of a mercaptan. Purified Iso catalyzed the isomerization of maleate acid to fumaric acid (Fig. 3E). The apparent K_m value of Iso was determined spectrophotometrically, monitoring maleate acid consumption at 290 nm. The assay was performed at 30°C in 50 mM Tris-HCl buffer (pH 8.4). The calculated apparent K_m for maleate acid was 0.689 mM, V_max was 9.4 U mg^-1 proteins, and k_cat was 4.0 s⁻¹ (Fig. 3F), respectively.

The hpo gene was deleted separately, and the related cell growth and resting cell reactions were all performed. The hpo gene deletion mutant could grow in nicotine medium and turn its color to saddle brown, whereas the color culture medium of the wild type strain S16 changed into pale green (Fig. 4A). Cells of hpo gene deletion mutant and wild type strain S16 were harvested in the mid-growth phase by centrifugation at 5,000 × g for 10 min at 4°C, washed three times with 0.02 M Tris-HCl buffer (pH 7) and suspended in the same buffer at OD_600 nm (called resting cells) value of 7. Resting cells of both cell types have the ability to transform nicotine (Fig. 4B). However, resting cells of hpo gene deletion mutant could not degrade DHP, different from the wild-type strain S16 (Fig. 4C). These results demonstrate that enzyme Hpo is crucial for DHP transformation and nicotine degradation by the strain.

Comparative genome analysis was performed using Mauve²⁰, and genomic islands (GIs) were analyzed using the IslandViewer software²¹. Phylogenetic tree construction using MEGA 4.1²² (containing genes hpo, nfo, ami and iso, Fig. 5A) showed that the gene cluster from S16 is most closely related to Octadecabacter antarcticus 238. The phylogenetic trees constructed with the neighbor joining (NJ) method for the individual proteins further refined the analysis, identifying similarities among these proteins (Fig. 5B). Hpo of P. putida S16 is closest to the ortholog from Rhizobium WSM1325, whereas Nfo and Ami are closest to O. antarcticus 238. Iso of P. putida S16 is in a deep branch of its own. Moreover, 29 GIs were identified in the complete genome of strain S16. The nic2 gene cluster is located within the largest GI (43,989 bp in length), which has a G+C content of 52.4% and codes for 8 transposases¹⁶ (Fig. S1). The GI containing the late pathway genes was not found in any of the 5 completely sequenced genome strains of P. putida namely P. putida KT2440, W619, F1, GB-1 and BIRD-1. The nicotinic acid degrading genes nicAB of P. putida KT2440¹⁸ were found in the genomes of 4 other P. putida strains. However, the nicAB genes were not found in the strain S16 genome. Attempts to degrade nicotinic acid by resting cells of strain S16 did not result in any degradation after 24 h of incubation (data not shown).

E. coli BL21(DE3) was employed as a host for both plasmids and the expression strain, cultured in Lysogeny broth medium and maintained at 37°C. P. putida S16 was grown in Nic medium and incubated at 30°C⁹.

Fdh, Gdh, formate, α-ketoglutaric acid, maleamic acid, maleic acid, fumaric acid, dithiothreitol, NADPH, and NAD, were obtained from Sigma-Aldrich (St. Louis, MO, USA). L-(-)-Nicotine (≥ 99% purity) was obtained from Fluka Chemie GmbH (Buchs Corp., Buchs, Switzerland).

The product was prepared as reported elsewhere with minor modifications²⁷. Maleic anhydride (10 g) was heated to 80°C under a nitrogen atmosphere in a 250-ml round bottom flask equipped with a reflux condenser. Anhydrous formamide was added (10 ml), and the reaction mixture was stirred slowly with a magnetic stirrer for 10 h at 80°C. The product was analyzed by NMR spectroscopy.

A fragment containing the gene cluster involved in the late steps of nicotine degradation was identified through data mining for amino acid sequences of NicX, NicD, NicF, and NicE of P. putida KT2440¹⁸ with the genome sequence of P. putida S16¹⁶. Each gene in the fragment was subcloned into pET28a and functionally analyzed. DNA manipulation and transformation were performed according to standard procedures³². The primers employed in this study are listed in Table 1. Primers were designed to incorporate an NcoI site in the forward primer and an XhoI site in the reverse primer. The DNA fragments bearing hpo, nfo, ami, and iso were amplified from genomic DNA using pfu polymerase (Tiangen, China) digested with NcoI and XhoI, and ligated into the NcoI-XhoI sites of pET28a. The resulting plasmids were used to transform E. coli BL21(DE3). Cells harboring the recombinant plasmids were cultured in LB medium containing 100 mg liter^-1 kanamycin and maintained at 37°C until the OD₆₀₀ reading reached 0.6. IPTG was then added to a final concentration of 1 mM and the cultures were incubated for another 6 h at 30°C to express the proteins. His₆-tagged Hpo, Nfo, Ami, and Iso were purified using a column of Ni-NTA agarose (Qiagen).

Hpo activity was measured at 20°C using a UV-Vis 2550 spectrophotometer (Shimadzu) at 320 nm (ε₃₂₀ = 5200 cm^-1 M^-1) as the previously reported¹⁷,¹⁸. The reaction mixture contained 0.02 mg ml^-1 DHP, 0.025 mM Fe²⁺, 18.2 mM Tris-HCl buffer (pH 8.0), and 0.0125 mg protein ml^-1 enzyme in a total volume of 1 ml. One unit of activity was defined as the amount of enzyme that catalyzed the disappearance of 1 μmol of substrate in 1 min.

Nfo and Ami activities were measured at 20°C, using the UV-Vis 2550 spectrophotometer at 340 nm. The Nfo assay mixture contained 695 μl Tris-HCl buffer (50 mM, pH 8.0), 5 μl NAD (0.33 M), 50 μl Fdh (9.2 unit ml^-1), 200 μl NFM (286 μmol l^-1), and 50 μl Nfo (0.57 mg protein ml^-1). The Ami assay mixture contained 480 μl buffer (50 mM Tris-HCl + 0.001 mol l^-1 EDTA), 200 μl maleamic acid (0.034 mol l^-1), 10 μl α-ketoglutaric acid (0.5 mol l^-1), 10 μl NADPH (0.01 mol l^-1), 100 μl Gdh (9.5 unit ml^-1), and 200 μl Ami (0.11 mg protein ml^-1).

Iso activity was measured at 30°C, using the UV-Vis 2550 spectrophotometer at 290 nm as previously reported³¹. The Iso assay mixture contained 50 mM Tris-Cl (pH 8.4), 10 μl 1-thioglycerol (500 mM), an appropriate volume of maleate (1 M, pH 7), and 5 μl isomerase (10.1 mg protein ml^-1) in a total volume of 1 ml.

DHP, NFM, maleamic acid, and maleic acid were detected by HPLC and confirmed by direct-insertion mass spectra recorded on the API 4000 LC-MS system. MS analysis was performed in both negative and positive-ion turbo ion spray ionization mode.

RT-PCR procedure was followed as previously reported¹⁴. Total RNA was isolated from P. putida S16 by using a Total RNA kit I (Omega, USA). Contaminating DNA was treated with DNase I (RNAse-free; Fermentas, EU) at 1 U per 1 μg of total RNA for 30 min at 37°C. RT-PCR was performed in 50-μl reaction mixtures containing approximately 400 ng of total RNA and 20 pmol of each primer with a Prime Script^TM one step RT-PCR kit (Takara, Japan). The amplification conditions employed for RT-PCR was as follows: 50°C for 30 min; 94°C for 2 min; 30 cycles of 94°C for 30 s; 57°C for hpo, nfo, and ami, 68°C for iso, and 72°C for 2 min. The primers employed in the amplification are listed in Table 1. RNA was used as a negative control to confirm the absence of DNA that may be contaminating the RNA preparations.

To delete the hpo gene in strain S16 by single homologous recombination, internal fragments were amplified by PCR and cloned into the polylinker region of pK18mob (hpo -347-f: CAGTGAATTCAACCTCCTGAGCTTCTGGCCC; hpo -708-r: CTTAGTCGACTTCAAGACCGCCGCGAATATC). The pK18mob-hpo was transformed and the deletion mutant was screened as previously described¹⁵.

The nucleotide sequence reported in the present study has been deposited in GenBank under accession number GQ857548.