spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 8 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
mmu-miR-27a* miR-27* Mus musculus
AGGGCUUAGCUGCUUGUGAGCA
Mus musculus
 
fru-miR-27b miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCUGCA
Gasterosteus aculeatus
 
rno-miR-27a* miR-27* Rattus norvegicus
AGGGCUUAGCUGCUUGUGAGCA
Rattus norvegicus
 
bta-miR-27b miR-27 Bos taurus
UUCACAGUGGCUAAGUUCUGC
Bos taurus
dre-miR-27e miR-27 Danio rerio
UUCACAGUGGCUAAGUUCAGUG
Danio rerio
hsa-miR-27a miR-27 Homo sapiens
UUCACAGUGGCUAAGUUCCGC
Homo sapiens
fru-miR-27e miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCAGUG
Gasterosteus aculeatus
ptr-miR-27a miR-27 Pan troglodytes
UUCACAGUGGCUAAGUUCCGCC
Pan troglodytes
xtr-miR-27b miR-27 Xenopus tropicalis
UUCACAGUGGCUAAGUUCUGC
Xenopus tropicalis
bta-miR-27a miR-27 Bos taurus
UUCACAGUGGCUAAGUUCCG
Canis familiaris
 
hsa-miR-27a* miR-27* Homo sapiens
AGGGCUUAGCUGCUUGUGAGCA
Homo sapiens
 
bta-miR-27a miR-27 Bos taurus
UUCACAGUGGCUAAGUUCCG
Ornithorhynchus anatinus
mdo-miR-27a miR-27 Monodelphis domestica
UUCACAGUGGCUAAGUUCCGC
Monodelphis domestica
fru-miR-27b miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCUGCA
Takifugu rubripes
tni-miR-27b miR-27 Tetraodon nigroviridis
UUCACAGUGGCUAAGUUCUGCA
Tetraodon nigroviridis
dre-miR-27b miR-27 Danio rerio
UUCACAGUGGCUAAGUUCUGCA
Danio rerio
fru-miR-27c miR-27 Takifugu rubripes
UUCACAGUGGUUAAGUUCUGC
Oryzias latipes
mmu-miR-27b miR-27 Mus musculus
UUCACAGUGGCUAAGUUCUGC
Mus musculus
rno-miR-27b miR-27 Rattus norvegicus
UUCACAGUGGCUAAGUUCUGC
Rattus norvegicus
bta-miR-27a miR-27 Bos taurus
UUCACAGUGGCUAAGUUCCG
Bos taurus
fru-miR-27e miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCAGUG
Takifugu rubripes
tni-miR-27e miR-27 Tetraodon nigroviridis
UUCACAGUGGCUAAGUUCAGUG
Tetraodon nigroviridis
dre-miR-27d miR-27 Danio rerio
UUCACAGUGGCUAAGUUCUUCA
Danio rerio
 
mmu-miR-27b* miR-27* Mus musculus
AGAGCUUAGCUGAUUGGUGAAC
Mus musculus
 
mml-miR-27a miR-27 Macaca mulatta
UUCACAGUGGCUAAGUUCCGCC
Macaca mulatta
fru-miR-27c miR-27 Takifugu rubripes
UUCACAGUGGUUAAGUUCUGC
Gasterosteus aculeatus
xtr-miR-27a miR-27 Xenopus tropicalis
UUCACAGUGGCUAAGUUCCGC
Xenopus tropicalis
 
dre-miR-27c* miR-27* Danio rerio
CUUAACCCACUUGUGAACAAUG
Danio rerio
 
gga-miR-27b miR-27 Gallus gallus
UUCACAGUGGCUAAGUUCUGC
Gallus gallus
hsa-miR-27b miR-27 Homo sapiens
UUCACAGUGGCUAAGUUCUGC
Homo sapiens
xtr-miR-27c miR-27 Xenopus tropicalis
UUCACAGUGGCUAAGUUCCAC
Xenopus tropicalis
bta-miR-27b miR-27 Bos taurus
UUCACAGUGGCUAAGUUCUGC
Canis familiaris
 
hsa-miR-27b* miR-27* Homo sapiens
AGAGCUUAGCUGAUUGGUGAAC
Homo sapiens
 
dre-miR-27a miR-27 Danio rerio
UUCACAGUGGCUAAGUUCCGCU
Danio rerio
bta-miR-27b miR-27 Bos taurus
UUCACAGUGGCUAAGUUCUGC
Ornithorhynchus anatinus
fru-miR-27b miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCUGCA
Oryzias latipes
 
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
Canis familiaris
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
Homo sapiens
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
Ornithorhynchus anatinus
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
Monodelphis domestica
mmu-miR-28 miR-28 Mus musculus
AAGGAGCUCACAGUCUAUUGAG
Mus musculus
mml-miR-28 miR-28 Macaca mulatta
AAGGAGCUCACAGUCUAUUGAG
Macaca mulatta
 
rno-miR-28* miR-28* Rattus norvegicus
CACUAGAUUGUGAGCUCCUGGA
Rattus norvegicus
 
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
Bos taurus
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
Gallus gallus
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
Canis familiaris
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
Homo sapiens
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
Ornithorhynchus anatinus
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
Monodelphis domestica
rno-miR-28 miR-28 Rattus norvegicus
AAGGAGCUCACAGUCUAUUGAG
Rattus norvegicus
hsa-miR-28-3p miR-28 Homo sapiens
CACUAGAUUGUGAGCUCCUGGA
Bos taurus
 
mmu-miR-28* miR-28* Mus musculus
CACUAGAUUGUGAGCUGCUGGA
Mus musculus
 
ptr-miR-28 miR-28 Pan troglodytes
AAGGAGCUCACAGUCUAUUGAG
Pan troglodytes
hsa-miR-28-5p miR-28 Homo sapiens
AAGGAGCUCACAGUCUAUUGAG
Gallus gallus
 
bta-miR-29c miR-29 Bos taurus
UAGCACCAUUUGAAAUCGGUUA
Bos taurus
xtr-miR-29b miR-29 Xenopus tropicalis
UAGCACCAUUUGAAAUCAGUGUU
Xenopus tropicalis
 
hsa-miR-29c* miR-29* Homo sapiens
UGACCGAUUUCUCCUGGUGUUC
Homo sapiens
 
gga-miR-29b miR-29 Gallus gallus
UAGCACCAUUUGAAAUCAGUGUU
Gallus gallus
 
mmu-miR-29a* miR-29* Mus musculus
ACUGAUUUCUUUUGGUGUUCAG
Mus musculus
rno-miR-29b-1* miR-29* Rattus norvegicus
UUUCAUAUGGUGGUUUAGAUUU
Rattus norvegicus
 
xtr-miR-29d miR-29 Xenopus tropicalis
UAGCACCAUAUGAAAUCAGUGUC
Xenopus tropicalis
bta-miR-29b miR-29 Bos taurus
UAGCACCAUUUGAAAUCAGUGUUU
Canis familiaris
 
mmu-miR-29c* miR-29* Mus musculus
UGACCGAUUUCUCCUGGUGUUC
Mus musculus
 
fru-miR-29a miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCGGUUA
Takifugu rubripes
tni-miR-29a miR-29 Tetraodon nigroviridis
UAGCACCAUUUGAAAUCGGUUA
Tetraodon nigroviridis
hsa-miR-29b miR-29 Homo sapiens
UAGCACCAUUUGAAAUCAGUGUU
Homo sapiens
bta-miR-29b miR-29 Bos taurus
UAGCACCAUUUGAAAUCAGUGUUU
Ornithorhynchus anatinus
 
rno-miR-29c* miR-29* Rattus norvegicus
UGACCGAUUUCUCCUGGUGUUC
Rattus norvegicus
 
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
Oryzias latipes
mdo-miR-29b miR-29 Monodelphis domestica
UAGCACCAUUUGAAAUCAGU
Monodelphis domestica
 
hsa-miR-29a* miR-29* Homo sapiens
ACUGAUUUCUUUUGGUGUUCAG
Homo sapiens
 
dre-miR-29a miR-29 Danio rerio
UAGCACCAUUUGAAAUCGGUUA
Danio rerio
mmu-miR-29a miR-29 Mus musculus
UAGCACCAUCUGAAAUCGGUUA
Mus musculus
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
Gasterosteus aculeatus
rno-miR-29b miR-29 Rattus norvegicus
UAGCACCAUUUGAAAUCAGUGUU
Rattus norvegicus
ptr-miR-29a miR-29 Pan troglodytes
CUAGCACCAUCUGAAAUCGGUU
Pan troglodytes
bta-miR-29b miR-29 Bos taurus
UAGCACCAUUUGAAAUCAGUGUUU
Bos taurus
xtr-miR-29a miR-29 Xenopus tropicalis
UAGCACCAUUUGAAAUCGGUU
Xenopus tropicalis
 
hsa-miR-29b-2* miR-29* Homo sapiens
CUGGUUUCACAUGGUGGCUUAG
Homo sapiens
 
gga-miR-29a miR-29 Gallus gallus
UAGCACCAUUUGAAAUCGGUU
Gallus gallus
mmu-miR-29c miR-29 Mus musculus
UAGCACCAUUUGAAAUCGGUUA
Mus musculus
 
rno-miR-29a* miR-29* Rattus norvegicus
ACUGAUUUCUUUUGGUGUUCAG
Rattus norvegicus
 
xtr-miR-29c miR-29 Xenopus tropicalis
UAGCACCAUUUGAAAUCGGU
Xenopus tropicalis
bta-miR-29a miR-29 Bos taurus
CUAGCACCAUCUGAAAUCGGUUA
Canis familiaris
gga-miR-29c miR-29 Gallus gallus
UAGCACCAUUUGAAAUCGGU
Gallus gallus
 
mmu-miR-29b* miR-29* Mus musculus
GCUGGUUUCAUAUGGUGGUUUA
Mus musculus
 
hsa-miR-29a miR-29 Homo sapiens
UAGCACCAUCUGAAAUCGGUUA
Homo sapiens
bta-miR-29a miR-29 Bos taurus
CUAGCACCAUCUGAAAUCGGUUA
Ornithorhynchus anatinus
 
rno-miR-29b-2* miR-29* Rattus norvegicus
CUGGUUUCACAUGGUGGCUUAG
Rattus norvegicus
 
fru-miR-29a miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCGGUUA
Oryzias latipes
 
xtr-miR-29c* miR-29* Xenopus tropicalis
UGACCGAUCUCUCUUGGUGUUC
Xenopus tropicalis
 
bta-miR-29c miR-29 Bos taurus
UAGCACCAUUUGAAAUCGGUUA
Canis familiaris
mdo-miR-29a miR-29 Monodelphis domestica
UAGCACCAUUUGAAAUCGGU
Monodelphis domestica
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
Takifugu rubripes
tni-miR-29b miR-29 Tetraodon nigroviridis
UAGCACCAUUUGAAAUCAGUGU
Tetraodon nigroviridis
hsa-miR-29c miR-29 Homo sapiens
UAGCACCAUUUGAAAUCGGUUA
Homo sapiens
bta-miR-29c miR-29 Bos taurus
UAGCACCAUUUGAAAUCGGUUA
Ornithorhynchus anatinus
mml-miR-29a miR-29 Macaca mulatta
CUAGCACCAUCUGAAAUCGGUU
Macaca mulatta
fru-miR-29a miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCGGUUA
Gasterosteus aculeatus
rno-miR-29a miR-29 Rattus norvegicus
UAGCACCAUCUGAAAUCGGUUA
Rattus norvegicus

Page 8 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 .. 88 next >>

spacer
spacer