spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 10 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
mdo-miR-31 miR-31 Monodelphis domestica
GGAGGCAAGAUGUUGGCAUAGCUG
Monodelphis domestica
dme-miR-31b miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGAAUAGCUG
Anopheles gambiae
 
hsa-miR-31* miR-31* Homo sapiens
UGCUAUGCCAACAUAUUGCCAU
Homo sapiens
 
dme-miR-31b miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGAAUAGCUG
Drosophila melanogaster
dps-miR-31a miR-31 Drosophila pseudoobscura
UGGCAAGAUGUCGGCAUAGCUGA
Drosophila pseudoobscura
 
mmu-miR-31* miR-31* Mus musculus
UGCUAUGCCAACAUAUUGCCAUC
Mus musculus
 
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
Danio rerio
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
Takifugu rubripes
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
Tetraodon nigroviridis
dme-miR-31a miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGCAUAGCUGA
Aedes aegypti
dme-miR-31a miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGCAUAGCUGA
Anopheles gambiae
hsa-miR-31 miR-31 Homo sapiens
AGGCAAGAUGCUGGCAUAGCU
Homo sapiens
dme-miR-31a miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGCAUAGCUGA
Drosophila melanogaster
mmu-miR-31 miR-31 Mus musculus
AGGCAAGAUGCUGGCAUAGCUG
Mus musculus
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
Oryzias latipes
gga-miR-31 miR-31 Gallus gallus
AGGCAAGAUGUUGGCAUAGCUG
Gallus gallus
mml-miR-31 miR-31 Macaca mulatta
GGCAAGAUGCUGGCAUAGCUG
Macaca mulatta
bta-miR-31 miR-31 Bos taurus
AGGCAAGAUGCUGGCAUAGCU
Canis familiaris
 
hsa-miR-32 miR-32 Homo sapiens
UAUUGCACAUUACUAAGUUGCA
Homo sapiens
mmu-miR-32 miR-32 Mus musculus
UAUUGCACAUUACUAAGUUGCA
Mus musculus
gga-miR-32 miR-32 Gallus gallus
UAUUGCACAUUACUAAGUUGC
Gallus gallus
mml-miR-32 miR-32 Macaca mulatta
UAUUGCACAUUACUAAGUUGC
Macaca mulatta
hsa-miR-32 miR-32 Homo sapiens
UAUUGCACAUUACUAAGUUGCA
Canis familiaris
 
hsa-miR-32* miR-32* Homo sapiens
CAAUUUAGUGUGUGUGAUAUUU
Homo sapiens
 
hsa-miR-32 miR-32 Homo sapiens
UAUUGCACAUUACUAAGUUGCA
Ornithorhynchus anatinus
rno-miR-32 miR-32 Rattus norvegicus
UAUUGCACAUUACUAAGUUGCA
Rattus norvegicus
ptr-miR-32 miR-32 Pan troglodytes
UAUUGCACAUUACUAAGUUGC
Pan troglodytes
hsa-miR-32 miR-32 Homo sapiens
UAUUGCACAUUACUAAGUUGCA
Bos taurus
mdo-miR-32 miR-32 Monodelphis domestica
UAUUGCACAUUACUAAGUUGC
Monodelphis domestica
 
hsa-miR-33b* miR-33* Homo sapiens
CAGUGCCUCGGCAGUGCAGCCC
Homo sapiens
 
dme-miR-33 miR-33 Drosophila melanogaster
AGGUGCAUUGUAGUCGCAUUG
Anopheles gambiae
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
Danio rerio
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
Oryzias latipes
dme-miR-33 miR-33 Drosophila melanogaster
AGGUGCAUUGUAGUCGCAUUG
Drosophila melanogaster
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
Takifugu rubripes
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
Tetraodon nigroviridis
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
Bos taurus
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
Monodelphis domestica
gga-miR-33 miR-33 Gallus gallus
GUGCAUUGUAGUUGCAUUG
Gallus gallus
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
Xenopus tropicalis
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
Gasterosteus aculeatus
mml-miR-33 miR-33 Macaca mulatta
GUGCAUUGUAGUUGCAUUG
Macaca mulatta
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
Canis familiaris
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
Homo sapiens
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
Ornithorhynchus anatinus
 
hsa-miR-33a* miR-33* Homo sapiens
CAAUGUUUCCACAGUGCAUCAC
Homo sapiens
mmu-miR-33* miR-33* Mus musculus
CAAUGUUUCCACAGUGCAUCAC
Mus musculus
 
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
Oryzias latipes
ptr-miR-33 miR-33 Pan troglodytes
GUGCAUUGUAGUUGCAUUG
Pan troglodytes
rno-miR-33 miR-33 Rattus norvegicus
GUGCAUUGUAGUUGCAUUGCA
Rattus norvegicus
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
Bos taurus
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
Danio rerio
dps-miR-33 miR-33 Drosophila pseudoobscura
AGGUGCAUUGUAGUCGCAUUG
Drosophila pseudoobscura
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
Takifugu rubripes
hsa-miR-33a miR-33 Homo sapiens
GUGCAUUGUAGUUGCAUUGCA
Monodelphis domestica
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
Tetraodon nigroviridis
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
Xenopus tropicalis
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
Gasterosteus aculeatus
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
Canis familiaris
dme-miR-33 miR-33 Drosophila melanogaster
AGGUGCAUUGUAGUCGCAUUG
Aedes aegypti
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
Homo sapiens
hsa-miR-33b miR-33 Homo sapiens
GUGCAUUGCUGUUGCAUUGC
Ornithorhynchus anatinus
mmu-miR-33 miR-33 Mus musculus
GUGCAUUGUAGUUGCAUUGCA
Mus musculus
 
mmu-miR-34b-5p miR-34 Mus musculus
AGGCAGUGUAAUUAGCUGAUUGU
Mus musculus
hsa-miR-34b miR-34 Homo sapiens
CAAUCACUAACUCCACUGCCAU
Homo sapiens
 
rno-miR-34c* miR-34* Rattus norvegicus
AAUCACUAACCACACAGCCAGG
Rattus norvegicus
 
bta-miR-34b miR-34 Bos taurus
AGGCAGUGUAAUUAGCUGAUUG
Bos taurus
mml-miR-34a miR-34 Macaca mulatta
UGGCAGUGUCUUAGCUGGUUGU
Macaca mulatta
bta-miR-34a miR-34 Bos taurus
UGGCAGUGUCUUAGCUGGUUGU
Canis familiaris
 
mmu-miR-34c* miR-34* Mus musculus
AAUCACUAACCACACAGCCAGG
Mus musculus
 
cel-miR-34 miR-34 Caenorhabditis elegans
AGGCAGUGUGGUUAGCUGGUUG
Caenorhabditis elegans
gga-miR-34b miR-34 Gallus gallus
CAGGCAGUGUAGUUAGCUGAUUG
Gallus gallus
hsa-miR-34c-5p miR-34 Homo sapiens
AGGCAGUGUAGUUAGCUGAUUGC
Homo sapiens
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
Oryzias latipes
dps-miR-34 miR-34 Drosophila pseudoobscura
UGGCAGUGUGGUUAGCUGGUUG
Drosophila pseudoobscura
bta-miR-34c miR-34 Bos taurus
AGGCAGUGUAGUUAGCUGAUUG
Canis familiaris
bta-miR-34a miR-34 Bos taurus
UGGCAGUGUCUUAGCUGGUUGU
Ornithorhynchus anatinus
 
hsa-miR-34b* miR-34* Homo sapiens
UAGGCAGUGUCAUUAGCUGAUUG
Homo sapiens
 
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
Danio rerio
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
Oryzias latipes
rno-miR-34a miR-34 Rattus norvegicus
UGGCAGUGUCUUAGCUGGUUGU
Rattus norvegicus
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
Takifugu rubripes
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
Tetraodon nigroviridis
bta-miR-34c miR-34 Bos taurus
AGGCAGUGUAGUUAGCUGAUUG
Ornithorhynchus anatinus
ptr-miR-34a miR-34 Pan troglodytes
UGGCAGUGUCUUAGCUGGUUGU
Pan troglodytes
xtr-miR-34a miR-34 Xenopus tropicalis
UGGCAGUGUCUUAGCUGGUUGUU
Xenopus tropicalis
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
Gasterosteus aculeatus
dme-miR-34 miR-34 Drosophila melanogaster
UGGCAGUGUGGUUAGCUGGUUGUG
Aedes aegypti
mmu-miR-34b-3p miR-34 Mus musculus
AAUCACUAACUCCACUGCCAUC
Mus musculus
hsa-miR-34a miR-34 Homo sapiens
UGGCAGUGUCUUAGCUGGUUGU
Homo sapiens
rno-miR-34c miR-34 Rattus norvegicus
AGGCAGUGUAGUUAGCUGAUUGC
Rattus norvegicus
bta-miR-34a miR-34 Bos taurus
UGGCAGUGUCUUAGCUGGUUGU
Bos taurus
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
Gasterosteus aculeatus
mmu-miR-34c miR-34 Mus musculus
AGGCAGUGUAGUUAGCUGAUUGC
Mus musculus
gga-miR-34a miR-34 Gallus gallus
UGGCAGUGUCUUAGCUGGUUGUU
Gallus gallus
hsa-miR-34c-3p miR-34 Homo sapiens
AAUCACUAACCACACGGCCAGG
Homo sapiens
dme-miR-34 miR-34 Drosophila melanogaster
UGGCAGUGUGGUUAGCUGGUUGUG
Anopheles gambiae
dme-miR-34 miR-34 Drosophila melanogaster
UGGCAGUGUGGUUAGCUGGUUGUG
Drosophila melanogaster
bta-miR-34c miR-34 Bos taurus
AGGCAGUGUAGUUAGCUGAUUG
Bos taurus
bta-miR-34b miR-34 Bos taurus
AGGCAGUGUAAUUAGCUGAUUG
Canis familiaris

Page 10 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 .. 88 next >>

spacer
spacer