spacer

MicroRNA Listing for Bos taurus


676 microRNAs (125 native)


Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-628-5p miR-628 Homo sapiens
AUGCUGACAUAUUUACUAGAGG
917 picture button
hsa-miR-629 miR-629 Homo sapiens
UGGGUUUACGUUGGGAGAACU
701 picture button
hsa-miR-630 miR-630 Homo sapiens
AGUAUUCUGUACCAGGGAAGGU
798 picture button
hsa-miR-631 miR-631 Homo sapiens
AGACCUGGCCCAGACCUCAGC
829 picture button
hsa-miR-632 miR-632 Homo sapiens
GUGUCUGCUUCCUGUGGGA
779 picture button
hsa-miR-633 miR-633 Homo sapiens
CUAAUAGUAUCUACCACAAUAAA
560 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
852 picture button
hsa-miR-635 miR-635 Homo sapiens
ACUUGGGCACUGAAACAAUGUCC
675 picture button
hsa-miR-636 miR-636 Homo sapiens
UGUGCUUGCUCGUCCCGCCCGCA
731 picture button
hsa-miR-637 miR-637 Homo sapiens
ACUGGGGGCUUUCGGGCUCUGCGU
657 picture button
hsa-miR-638 miR-638 Homo sapiens
AGGGAUCGCGGGCGGGUGGCGGCCU
687 picture button
hsa-miR-639 miR-639 Homo sapiens
AUCGCUGCGGUUGCGAGCGCUGU
764 picture button
hsa-miR-640 miR-640 Homo sapiens
AUGAUCCAGGAACCUGCCUCU
839 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
684 picture button
hsa-miR-642 miR-642 Homo sapiens
GUCCCUCUCCAAAUGUGUCUUG
620 picture button
hsa-miR-643 miR-643 Homo sapiens
ACUUGUAUGCUAGCUCAGGUAG
704 picture button
hsa-miR-644 miR-644 Homo sapiens
AGUGUGGCUUUCUUAGAGC
810 picture button
hsa-miR-645 miR-645 Homo sapiens
UCUAGGCUGGUACUGCUGA
681 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
855 picture button
hsa-miR-647 miR-647 Homo sapiens
GUGGCUGCACUCACUUCCUUC
842 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
835 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
838 picture button
hsa-miR-650 miR-650 Homo sapiens
AGGAGGCAGCGCUCUCAGGAC
770 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
617 picture button
hsa-miR-652 miR-652 Homo sapiens
AAUGGCGCCACUAGGGUUGUG
777 picture button
hsa-miR-653 miR-653 Homo sapiens
GUGUUGAAACAAUCUCUACUG
651 picture button
hsa-miR-654-3p miR-654 Homo sapiens
UAUGUCUGCUGACCAUCACCUU
807 picture button
hsa-miR-654-5p miR-654 Homo sapiens
UGGUGGGCCGCAGAACAUGUGC
998 picture button
hsa-miR-655 miR-655 Homo sapiens
AUAAUACAUGGUUAACCUCUUU
705 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
556 picture button
hsa-miR-657 miR-657 Homo sapiens
GGCAGGUUCUCACCCUCUCUAGG
725 picture button
hsa-miR-658 miR-658 Homo sapiens
GGCGGAGGGAAGUAGGUCCGUUGGU
722 picture button
hsa-miR-659 miR-659 Homo sapiens
CUUGGUUCAGGGAGGGUCCCCA
739 picture button
bta-miR-660 miR-660 Bos taurus
UACCCAUUGCAUAUCGGAGCUG
731 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
618 picture button
hsa-miR-662 miR-662 Homo sapiens
UCCCACGUUGUGGCCCAGCAG
792 picture button
hsa-miR-663 miR-663 Homo sapiens
AGGCGGGGCGCCGCGGGACCGC
796 picture button
rno-miR-664 miR-664 Rattus norvegicus
UAUUCAUUUACUCCCCAGCCUA
704 picture button
hsa-miR-665 miR-665 Homo sapiens
ACCAGGAGGCUGAGGCCCCU
734 picture button
mmu-miR-666-3p miR-666 Mus musculus
GGCUGCAGCGUGAUCGCCUGCU
839 picture button
mmu-miR-666-5p miR-666 Mus musculus
AGCGGGCACAGCUGUGAGAGCC
925 picture button
mmu-miR-667 miR-667 Mus musculus
UGACACCUGCCACCCAGCCCAAG
825 picture button
hsa-miR-668 miR-668 Homo sapiens
UGUCACUCGGCUCGGCCCACUAC
766 picture button
mmu-miR-669b miR-669 Mus musculus
AGUUUUGUGUGCAUGUGCAUGU
791 picture button
mmu-miR-669a miR-669 Mus musculus
AGUUGUGUGUGCAUGUUCAUGU
762 picture button
mmu-miR-669c miR-669 Mus musculus
AUAGUUGUGUGUGGAUGUGUGU
796 picture button
mmu-miR-670 miR-670 Mus musculus
AUCCCUGAGUGUAUGUGGUGAA
856 picture button
hsa-miR-671-3p miR-671 Homo sapiens
UCCGGUUCUCAGGGCUCCACC
841 picture button
hsa-miR-671-5p miR-671 Homo sapiens
AGGAAGCCCUGGAGGGGCUGGAG
923 picture button
hsa-miR-672 miR-672 Homo sapiens
UGAGGUUGGUGUACUGUGUGUGA
701 picture button
mmu-miR-673-3p miR-673 Mus musculus
UCCGGGGCUGAGUUCUGUGCACC
899 picture button
mmu-miR-673-5p miR-673 Mus musculus
CUCACAGCUCUGGUCCUUGGAG
982 picture button
hsa-miR-674 miR-674 Homo sapiens
GCACUGAGAUGGGAGUGGUGUA
920 picture button
hsa-miR-675 miR-675 Homo sapiens
UGGUGCGGAGAGGGCCCACAGUG
787 picture button
mmu-miR-676 miR-676 Mus musculus
CCGUCCUGAGGUUGUUGAGCU
673 picture button
mmu-miR-677 miR-677 Mus musculus
UUCAGUGAUGAUUAGCUUCUGA
796 picture button
mmu-miR-678 miR-678 Mus musculus
GUCUCGGUGCAAGGACUGGAGG
707 picture button
mmu-miR-679 miR-679 Mus musculus
GGACUGUGAGGUGACUCUUGGU
823 picture button
mmu-miR-680 miR-680 Mus musculus
GGGCAUCUGCUGACAUGGGGG
784 picture button
mmu-miR-681 miR-681 Mus musculus
CAGCCUCGCUGGCAGGCAGCU
732 picture button
mmu-miR-682 miR-682 Mus musculus
CUGCAGUCACAGUGAAGUCUG
813 picture button
mmu-miR-683 miR-683 Mus musculus
CCUGCUGUAAGCUGUGUCCUC
707 picture button
mmu-miR-684 miR-684 Mus musculus
AGUUUUCCCUUCAAGUCAA
618 picture button
mmu-miR-685 miR-685 Mus musculus
UCAAUGGCUGAGGUGAGGCAC
757 picture button
mmu-miR-686 miR-686 Mus musculus
AUUGCUUCCCAGACGGUGAAGA
724 picture button
mmu-miR-687 miR-687 Mus musculus
CUAUCCUGGAAUGCAGCAAUGA
837 picture button
mmu-miR-688 miR-688 Mus musculus
UCGCAGGCGACUACUUAUUC
672 picture button
mmu-miR-689 miR-689 Mus musculus
CGUCCCCGCUCGGCGGGGUCC
724 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
748 picture button
mmu-miR-691 miR-691 Mus musculus
AUUCCUGAAGAGAGGCAGAAAA
783 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
484 picture button
mmu-miR-693-3p miR-693 Mus musculus
GCAGCUUUCAGAUGUGGCUGUAA
877 picture button
mmu-miR-693-5p miR-693 Mus musculus
CAGCCACAUCCGAAAGUUUUC
993 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
464 picture button
mmu-miR-695 miR-695 Mus musculus
AGAUUGGGCAUAGGUGACUGAA
675 picture button
mmu-miR-696 miR-696 Mus musculus
GCGUGUGCUUGCUGUGGG
811 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
840 picture button
mmu-miR-698 miR-698 Mus musculus
CAUUCUCGUUUCCUUCCCU
679 picture button
mmu-miR-699 miR-699 Mus musculus
AGGCAGUGCGACCUGGCUCG
801 picture button
mmu-miR-700 miR-700 Mus musculus
CACGCGGGAACCGAGUCCACC
771 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
737 picture button
mmu-miR-702 miR-702 Mus musculus
UGCCCACCCUUUACCCCGCUC
800 picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
915 picture button
mmu-miR-704 miR-704 Mus musculus
AGACAUGUGCUCUGCUCCUAG
722 picture button
mmu-miR-705 miR-705 Mus musculus
GGUGGGAGGUGGGGUGGGCA
806 picture button
mmu-miR-706 miR-706 Mus musculus
AGAGAAACCCUGUCUCAAAAAA
744 picture button
mmu-miR-707 miR-707 Mus musculus
CAGUCAUGCCGCUUGCCUACG
839 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
632 picture button
mmu-miR-709 miR-709 Mus musculus
GGAGGCAGAGGCAGGAGGA
725 picture button
mmu-miR-710 miR-710 Mus musculus
CCAAGUCUUGGGGAGAGUUGAG
832 picture button
mmu-miR-711 miR-711 Mus musculus
GGGACCCGGGGAGAGAUGUAAG
723 picture button
mmu-miR-712 miR-712 Mus musculus
CUCCUUCACCCGGGCGGUACC
639 picture button
mmu-miR-713 miR-713 Mus musculus
UGCACUGAAGGCACACAGC
896 picture button
mmu-miR-714 miR-714 Mus musculus
CGACGAGGGCCGGUCGGUCGC
776 picture button
mmu-miR-715 miR-715 Mus musculus
CUCCGUGCACACCCCCGCGUG
806 picture button
mmu-miR-717 miR-717 Mus musculus
CUCAGACAGAGAUACCUUCUCU
734 picture button
mmu-miR-718 miR-718 Mus musculus
CUUCCGCCCGGCCGGGUGUCG
680 picture button
mmu-miR-719 miR-719 Mus musculus
AUCUCGGCUACAGAAAAAUGUU
652 picture button
mmu-miR-720 miR-720 Mus musculus
AUCUCGCUGGGGCCUCCA
737 picture button
mmu-miR-721 miR-721 Mus musculus
CAGUGCAAUUAAAAGGGGGAA
894 picture button

Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer