spacer

MicroRNA Listing for Gasterosteus aculeatus


172 microRNAs (0 native)


Page 2 of 2
<< prev 1 2

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
fru-miR-200a miR-200 Takifugu rubripes
UAACACUGUCUGGUAACGAUGU
1115 picture button
fru-miR-200b miR-200 Takifugu rubripes
UAAUACUGCCUGGUAAUGAUGA
1070 picture button
fru-miR-202 miR-202 Takifugu rubripes
AGAGGCAUAGGGCAUGGGAAAA
746 picture button
fru-miR-203 miR-203 Takifugu rubripes
GUGAAAUGUUUAGGACCACUUG
645 picture button
fru-miR-204 miR-204 Takifugu rubripes
UUCCCUUUGUCAUCCUAUGCCU
751 picture button
fru-miR-205 miR-205 Takifugu rubripes
UCCUUCAUUCCACCGGAGUCUG
801 picture button
dre-miR-206 miR-206 Danio rerio
UGGAAUGUAAGGAAGUGUGUGG
726 picture button
xtr-miR-208 miR-208 Xenopus tropicalis
AUAAGACGAGCAUAAAGCUUGU
702 picture button
fru-miR-210 miR-210 Takifugu rubripes
CUGUGCGUGUGACAGCGGCUAA
838 picture button
fru-miR-212 miR-212 Takifugu rubripes
UAACAGUCUACAGUCAUGGCU
971 picture button
fru-miR-214 miR-214 Takifugu rubripes
ACAGCAGGCACAGACAGGCAG
696 picture button
xtr-miR-215 miR-215 Xenopus tropicalis
AUGACCUAUGAAAUGACAGCC
828 picture button
fru-miR-216a miR-216 Takifugu rubripes
AAAUCUCAGCUGGCAACUGUGA
1063 picture button
fru-miR-216b miR-216 Takifugu rubripes
UAAUCUCUGCAGGCAACUGUGA
946 picture button
fru-miR-217 miR-217 Takifugu rubripes
UACUGCAUCAGGAACUGAUUGG
801 picture button
fru-miR-218a miR-218 Takifugu rubripes
UUGUGCUUGAUCUAACCAUGUG
817 picture button
fru-miR-218b miR-218 Takifugu rubripes
UUGUGCUUGAUCUAACCAUGCA
810 picture button
fru-miR-219 miR-219 Takifugu rubripes
UGAUUGUCCAAACGCAAUUCUU
892 picture button
dre-miR-220 miR-220 Danio rerio
CCACAACCGUAUCGGACACUU
965 picture button
fru-miR-221 miR-221 Takifugu rubripes
AGCUACAUUGUCUGCUGGGUUUC
920 picture button
fru-miR-222 miR-222 Takifugu rubripes
AGCUACAUCUGGCUACUGGGUCUC
890 picture button
fru-miR-223 miR-223 Takifugu rubripes
UGUCAGUUUGUCAAAUACCCC
750 picture button
fru-miR-301 miR-301 Takifugu rubripes
CAGUGCAAUAGUAUUGUCAUAG
863 picture button
xtr-miR-302 miR-302 Xenopus tropicalis
UAAGUGCUCCAAUGUUUUAGUGG
813 picture button
fru-miR-338 miR-338 Takifugu rubripes
UCCAGCAUCAGUGAUUUUGUUG
879 picture button
dre-miR-363 miR-363 Danio rerio
AAUUGCACGGUAUCCAUCUGUA
891 picture button
fru-miR-365 miR-365 Takifugu rubripes
UAAUGCCCCUAAAAAUCCUUAU
870 picture button
xtr-miR-367 miR-367 Xenopus tropicalis
AAUUGCACUGUAGCAAUGGUGA
904 picture button
fru-miR-375 miR-375 Takifugu rubripes
UUUGUUCGUUCGGCUCGCGUUA
653 picture button
xtr-miR-383 miR-383 Xenopus tropicalis
AGAUCAGAAGGUGAUUGUGGCU
793 picture button
xtr-miR-425-5p miR-425 Xenopus tropicalis
AAUGACACGAUCACUCCCGUUGA
899 picture button
xtr-miR-428 miR-428 Xenopus tropicalis
UAAGUGCUCUCUAGUUCGGUUG
718 picture button
fru-miR-429 miR-429 Takifugu rubripes
UAAUACUGUCUGGUAAUGCCGU
958 picture button
dre-miR-430j miR-430 Danio rerio
AAAGUGCUAUCAAAUUGGGGUA
883 picture button
dre-miR-430b miR-430 Danio rerio
AAAGUGCUAUCAAGUUGGGGUAG
860 picture button
dre-miR-430i miR-430 Danio rerio
UAAGUGCUAUUUGUUGGCGUAG
852 picture button
dre-miR-430a miR-430 Danio rerio
UAAGUGCUAUUUGUUGGGGUAG
841 picture button
dre-miR-430c miR-430 Danio rerio
UAAGUGCUUCUCUUUGGGGUAG
995 picture button
xtr-miR-449 miR-449 Xenopus tropicalis
AGGCAGUGUAAUGUUAGCUGGU
750 picture button
dre-miR-451 miR-451 Danio rerio
AAACCGUUACCAUUACUGAGUU
920 picture button
dre-miR-454b miR-454 Danio rerio
UAGUGCAAUAUUGCUUAUAGGG
867 picture button
dre-miR-454a miR-454 Danio rerio
UAGUGCAAUAUUGCUAAUAGGG
874 picture button
fru-miR-455 miR-455 Takifugu rubripes
UAUGUGCCCUUGGACUACAUCG
895 picture button
dre-miR-456 miR-456 Danio rerio
CAGGCUGGUUAGAUGGUUGUCA
747 picture button
dre-miR-457b miR-457 Danio rerio
AAGCAGCACAUAAAUACUGGAG
733 picture button
dre-miR-457a miR-457 Danio rerio
AAGCAGCACAUCAAUAUUGGCA
678 picture button
fru-miR-458 miR-458 Takifugu rubripes
AUAGCUCUUUAAAUGGUACUGC
619 picture button
dre-miR-459 miR-459 Danio rerio
UCAGUAACAAGGAUUCAUCCUG
796 picture button
fru-miR-460 miR-460 Takifugu rubripes
CACAGCGCAUACAAUGUGGAUG
910 picture button
dre-miR-461 miR-461 Danio rerio
UCAGGAAUGGGCUAAAUGCCAA
615 picture button
dre-miR-462 miR-462 Danio rerio
UAACGGAACCCAUAAUGCAGCU
666 picture button
fru-miR-489 miR-489 Takifugu rubripes
AGUGACAUCAUAUGUACGGCUGC
754 picture button
dre-miR-499 miR-499 Danio rerio
UUAAGACUUGCAGUGAUGUUUA
831 picture button
dre-miR-722 miR-722 Danio rerio
UUUUUUGCAGAAACGUUUCAGAUU
652 picture button
dre-miR-723 miR-723 Danio rerio
AAGACAUCAAUUAAAUCUGUGCU
709 picture button
dre-miR-724 miR-724 Danio rerio
UUAAAGGGAAUUUGCGACUGUU
513 picture button
dre-miR-725 miR-725 Danio rerio
UUCAGUCAUUGUUUCUAGUAGU
889 picture button
dre-miR-726 miR-726 Danio rerio
UUCACUACUAGCAGAACUCGG
812 picture button
dre-miR-727 miR-727 Danio rerio
GUUGAGGCGAGUUGAAGACUUA
657 picture button
dre-miR-728 miR-728 Danio rerio
AUACUAAGUACACUACGUUUUC
646 picture button
dre-miR-729 miR-729 Danio rerio
CAUGGGUAUGAUACGACCUGGGUU
679 picture button
dre-miR-730 miR-730 Danio rerio
UCCUCAUUGUGCAUGCUGUGUGU
743 picture button
dre-miR-731 miR-731 Danio rerio
AAUGACACGUUUUCUCCCGGAUCG
762 picture button
dre-miR-732 miR-732 Danio rerio
CUCAAAGCAGAGAACUCUCGGU
791 picture button
dre-miR-733 miR-733 Danio rerio
UGCGUUGGUUUAGCUCAGUGGUU
679 picture button
dre-miR-734 miR-734 Danio rerio
GUAAAUGCUGCAGAAUCGUACCG
698 picture button
dre-miR-735 miR-735 Danio rerio
CUCUCCCACCGCUAAACUUGAC
825 picture button
dre-miR-736 miR-736 Danio rerio
GUAAGACGAACAAAAAGUUUU
630 picture button
dre-miR-737 miR-737 Danio rerio
AAUCAAAACCUAAAGAAAAUA
666 picture button
dre-miR-738 miR-738 Danio rerio
GCUACGGCCCGCGUCGGGACCUC
727 picture button
dre-miR-739 miR-739 Danio rerio
AGGCCGAAGUGGAGAAGGGUU
755 picture button
dre-miR-740 miR-740 Danio rerio
AUAAAAAGUGGUAUGGUACAGU
461 picture button

Page 2 of 2
<< prev 1 2

spacer
spacer