spacer

MicroRNA Listing for Danio rerio


233 microRNAs (219 native)


Page 1 of 3
1 2 3 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
dre-miR-740 miR-740 Danio rerio
AUAAAAAGUGGUAUGGUACAGU
477 picture button
dre-miR-126* miR-126* Danio rerio
CAUUAUUACUUUUGGUACGCG
521 picture button
dre-miR-459* miR-459* Danio rerio
CAGGGAAUCUCUGUUACUGGGG
540 picture button
dre-miR-461 miR-461 Danio rerio
UCAGGAAUGGGCUAAAUGCCAA
543 picture button
dre-miR-19a* miR-19* Danio rerio
CUAGUUUUGCAUAGUUGCACUA
549 picture button
dre-miR-17a* miR-17* Danio rerio
ACUGCAGUGGAGGCACUUCUAG
575 picture button
dre-miR-30e* miR-30* Danio rerio
CUUUCAGUCGGAUGUUUGCAGC
578 picture button
dre-miR-462 miR-462 Danio rerio
UAACGGAACCCAUAAUGCAGCU
586 picture button
dre-miR-203b* miR-203* Danio rerio
AGUGGUUCUCAACAGUUCAACA
606 picture button
dre-miR-736 miR-736 Danio rerio
GUAAGACGAACAAAAAGUUUU
609 picture button
dre-miR-723* miR-723* Danio rerio
GACAGUUUUAAAUGAUGUUACUUU
610 picture button
dre-miR-203a miR-203 Danio rerio
GUGAAAUGUUUAGGACCACUUG
611 picture button
dre-miR-142b-5p miR-142 Danio rerio
CAUAAAGUAGACAGCACUACUA
614 picture button
dre-miR-19b* miR-19* Danio rerio
AGUUUUGCUGGUUUGCAUUCAG
623 picture button
dre-miR-129 miR-129 Danio rerio
CUUUUUGCGGUCUGGGCUUGCU
623 picture button
dre-miR-142a-5p miR-142 Danio rerio
CAUAAAGUAGAAAGCACUACU
627 picture button
dre-miR-724 miR-724 Danio rerio
UUAAAGGGAAUUUGCGACUGUU
638 picture button
dre-miR-728 miR-728 Danio rerio
AUACUAAGUACACUACGUUUUC
644 picture button
dre-miR-182* miR-182* Danio rerio
UGGUUCUAGACUUGCCAACUA
647 picture button
dre-miR-187 miR-187 Danio rerio
UCGUGUCUUGUGUUGCAGCC
648 picture button
dre-miR-199* miR-199* Danio rerio
UACAGUAGUCUGCACAUUGGUU
648 picture button
dre-miR-203b miR-203 Danio rerio
GUGAAAUGUUCAGGACCACUUG
648 picture button
dre-miR-722 miR-722 Danio rerio
UUUUUUGCAGAAACGUUUCAGAUU
653 picture button
dre-miR-129* miR-129* Danio rerio
AAGCCCUUACCCCAAAAAGCAU
658 picture button
dre-miR-458 miR-458 Danio rerio
AUAGCUCUUUGAAUGGUACUGC
658 picture button
dre-miR-9* miR-9* Danio rerio
UAAAGCUAGAUAACCGAAAGU
661 picture button
xtr-miR-208 miR-208 Xenopus tropicalis
AUAAGACGAGCAUAAAGCUUGU
663 picture button
dre-miR-132* miR-132* Danio rerio
ACCGUGGCAUUAGAUUGUUACU
665 picture button
dre-miR-729 miR-729 Danio rerio
CAUGGGUAUGAUACGACCUGGGUU
666 picture button
dre-miR-733 miR-733 Danio rerio
UGCGUUGGUUUAGCUCAGUGGUU
671 picture button
dre-miR-737 miR-737 Danio rerio
AAUCAAAACCUAAAGAAAAUA
680 picture button
dre-miR-9 miR-9 Danio rerio
UCUUUGGUUAUCUAGCUGUAUGA
685 picture button
dre-miR-7a miR-7 Danio rerio
UGGAAGACUAGUGAUUUUGUUGU
686 picture button
dre-miR-143 miR-143 Danio rerio
UGAGAUGAAGCACUGUAGCUC
689 picture button
dre-miR-727 miR-727 Danio rerio
GUUGAGGCGAGUUGAAGACUUA
690 picture button
xtr-miR-428 miR-428 Xenopus tropicalis
UAAGUGCUCUCUAGUUCGGUUG
695 picture button
dre-miR-10a* miR-10* Danio rerio
CAAAUUCGUGUCUUGGGGAAUA
699 picture button
dre-miR-18b* miR-18* Danio rerio
CUGCCCUAAGUGCCCCUUCUGG
699 picture button
dre-miR-133a* miR-133* Danio rerio
AGCUGGUAAAAUGGAACCAAAU
699 picture button
dre-miR-202* miR-202* Danio rerio
UUCCUAUGCAUAUACCUCUUUG
699 picture button
dre-miR-734 miR-734 Danio rerio
GUAAAUGCUGCAGAAUCGUACCG
702 picture button
dre-miR-223 miR-223 Danio rerio
UGUCAGUUUGUCAAAUACCCC
703 picture button
dre-miR-499 miR-499 Danio rerio
UUAAGACUUGCAGUGAUGUUUA
704 picture button
dre-miR-15a* miR-15* Danio rerio
CAGGCCGUACUGUGCUGCGGCA
706 picture button
dre-miR-20a* miR-20* Danio rerio
ACUGCAGUGUGAGCACUUGAAG
706 picture button
dre-miR-210* miR-210* Danio rerio
AGCCACUGACUAACGCACAUUG
706 picture button
dre-miR-206 miR-206 Danio rerio
UGGAAUGUAAGGAAGUGUGUGG
710 picture button
dre-miR-7b miR-7 Danio rerio
UGGAAGACUUGUGAUUUUGUU
711 picture button
dre-miR-30d miR-30 Danio rerio
UGUAAACAUCCCCGACUGGAAG
713 picture button
dre-miR-1 miR-1 Danio rerio
UGGAAUGUAAAGAAGUAUGUAU
715 picture button
dre-miR-727* miR-727* Danio rerio
UCAGUCUUCAAUUCCUCCCAGC
721 picture button
dre-miR-16c miR-16 Danio rerio
UAGCAGCAUGUAAAUAUUGGAG
723 picture button
dre-miR-190 miR-190 Danio rerio
UGAUAUGUUUGAUAUAUUAGGU
723 picture button
dre-miR-457b miR-457 Danio rerio
AAGCAGCACAUAAAUACUGGAG
724 picture button
dre-miR-140 miR-140 Danio rerio
CAGUGGUUUUACCCUAUGGUAG
725 picture button
dre-miR-457a miR-457 Danio rerio
AAGCAGCACAUCAAUAUUGGCA
725 picture button
dre-miR-16b miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGAG
728 picture button
dre-miR-107 miR-107 Danio rerio
AGCAGCAUUGUACAGGGCUAUCA
728 picture button
dre-miR-181a* miR-181* Danio rerio
ACCAUCGACCGUUGAUUGUACC
729 picture button
dre-miR-133b* miR-133* Danio rerio
GCUGGUCAAAUGGAACCAAGUC
730 picture button
dre-miR-21 miR-21 Danio rerio
UAGCUUAUCAGACUGGUGUUGGC
734 picture button
dre-miR-375 miR-375 Danio rerio
UUUGUUCGUUCGGCUCGCGUUA
737 picture button
dre-miR-144 miR-144 Danio rerio
UACAGUAUAGAUGAUGUACU
738 picture button
xtr-miR-383 miR-383 Xenopus tropicalis
AGAUCAGAAGGUGAUUGUGGCU
739 picture button
dre-miR-456 miR-456 Danio rerio
CAGGCUGGUUAGAUGGUUGUCA
740 picture button
dre-miR-27b miR-27 Danio rerio
UUCACAGUGGCUAAGUUCUGCA
741 picture button
dre-miR-153c miR-153 Danio rerio
UUGCAUAGUCACAAAAAUGAUC
741 picture button
xtr-miR-191 miR-191 Xenopus tropicalis
CAACGGAAUCCCAAAAGCAGCU
743 picture button
dre-miR-18c miR-18 Danio rerio
UAAGGUGCAUCUUGUGUAGUUA
744 picture button
dre-miR-103 miR-103 Danio rerio
AGCAGCAUUGUACAGGGCUAUGA
744 picture button
dre-miR-19c miR-19 Danio rerio
UGUGCAAAUCCAUGCAAAACUCG
745 picture button
dre-miR-190b miR-190 Danio rerio
UGAUAUGUUUGAUAUUCGGUUG
746 picture button
dre-miR-16a miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGUG
747 picture button
dre-miR-30c miR-30 Danio rerio
UGUAAACAUCCUACACUCUCAG
748 picture button
dre-miR-202 miR-202 Danio rerio
AGAGGCAUAGGGCAUGGGAAAA
748 picture button
dre-miR-19a miR-19 Danio rerio
UGUGCAAAUCUAUGCAAAACUGA
749 picture button
dre-miR-731 miR-731 Danio rerio
AAUGACACGUUUUCUCCCGGAUCG
749 picture button
xtr-miR-449 miR-449 Xenopus tropicalis
AGGCAGUGUAAUGUUAGCUGGU
751 picture button
dre-miR-10d* miR-10* Danio rerio
CAGAUUCGGUUUUAGGGGAGUA
754 picture button
dre-miR-430j miR-430 Danio rerio
AAAGUGCUAUCAAAUUGGGGUA
756 picture button
dre-miR-210 miR-210 Danio rerio
CUGUGCGUGUGACAGCGGCUAA
757 picture button
dre-miR-730 miR-730 Danio rerio
UCCUCAUUGUGCAUGCUGUGUGU
758 picture button
dre-miR-142a-3p miR-142 Danio rerio
UGUAGUGUUUCCUACUUUAUGGA
760 picture button
dre-miR-122 miR-122 Danio rerio
UGGAGUGUGACAAUGGUGUUUG
762 picture button
dre-miR-30b miR-30 Danio rerio
UGUAAACAUCCUACACUCAGCU
763 picture button
dre-miR-27d miR-27 Danio rerio
UUCACAGUGGCUAAGUUCUUCA
764 picture button
dre-miR-30a miR-30 Danio rerio
UGUAAACAUUCCCGACUGGAAG
764 picture button
dre-miR-128 miR-128 Danio rerio
UCACAGUGAACCGGUCUCUUUU
766 picture button
xtr-miR-215 miR-215 Xenopus tropicalis
AUGACCUAUGAAAUGACAGCC
767 picture button
dre-miR-135b miR-135 Danio rerio
UAUGGCUUUUUAUUCCUAUCUG
768 picture button
dre-miR-430i miR-430 Danio rerio
UAAGUGCUAUUUGUUGGCGUAG
768 picture button
dre-miR-738 miR-738 Danio rerio
GCUACGGCCCGCGUCGGGACCUC
771 picture button
dre-miR-18a miR-18 Danio rerio
UAAGGUGCAUCUAGUGCAGAUA
772 picture button
dre-miR-460-5p miR-460 Danio rerio
CCUGCAUUGUACACACUGUGCG
772 picture button
dre-miR-732 miR-732 Danio rerio
CUCAAAGCAGAGAACUCUCGGU
773 picture button
xtr-miR-98 miR-98 Xenopus tropicalis
UGAGGUAGUAAGUUGUAUUGUU
774 picture button
dre-miR-145 miR-145 Danio rerio
GUCCAGUUUUCCCAGGAAUCCC
774 picture button
dre-miR-430a miR-430 Danio rerio
UAAGUGCUAUUUGUUGGGGUAG
775 picture button
dre-miR-150 miR-150 Danio rerio
UCUCCCAAUCCUUGUACCAGUG
776 picture button
dre-miR-153b miR-153 Danio rerio
UUGCAUAGUCACAAAAAUGAGC
776 picture button

Page 1 of 3
1 2 3 next >>

spacer
spacer