spacer

MicroRNA Listing for Xenopus tropicalis


199 microRNAs (159 native)


Page 1 of 2
1 2 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
xtr-let-7f let-7 Xenopus tropicalis
UGAGGUAGUAGAUUGUAUAGU
712 picture button
xtr-let-7b let-7 Xenopus tropicalis
UGAGGUAGUAGUUUGUGUAGUU
729 picture button
xtr-let-7i let-7 Xenopus tropicalis
UGAGGUAGUAGUUUGUGCUGU
735 picture button
xtr-let-7e let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUUUAGUU
730 picture button
xtr-let-7a let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUAUAGUU
743 picture button
xtr-let-7g let-7 Xenopus tropicalis
UGAGGUAGUUGUUUGUACAGU
726 picture button
xtr-let-7c let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUAUGGUU
749 picture button
xtr-miR-1b miR-1 Xenopus tropicalis
UGGAAUGUUAAGAAGUAUGUA
573 picture button
xtr-miR-1a miR-1 Xenopus tropicalis
UGGAAUGUAAAGAAGUAUGUA
610 picture button
xtr-miR-7 miR-7 Xenopus tropicalis
UGGAAGACUAGUGAUUUUGUUG
622 picture button
xtr-miR-9b* miR-9* Xenopus tropicalis
UAAAGCUAGACAACCGAACGU
619 picture button
xtr-miR-9a miR-9 Xenopus tropicalis
UCUUUGGUUAUCUAGCUGUAUGA
603 picture button
xtr-miR-9* miR-9* Xenopus tropicalis
UAAAGCUAGAUAACCGAAAGU
629 picture button
xtr-miR-9 miR-9 Xenopus tropicalis
UCUUUGGUUAUCUAGCUGUAUG
609 picture button
xtr-miR-9b miR-9 Xenopus tropicalis
UCUUUGGUUACCUAGCUGUAUGA
573 picture button
xtr-miR-10a miR-10 Xenopus tropicalis
UACCCUGUAGAUCCGAAUUUGUG
778 picture button
xtr-miR-10c miR-10 Xenopus tropicalis
CACCCUGUAGAAUCGAAUUUGU
743 picture button
xtr-miR-10b miR-10 Xenopus tropicalis
UACCCUGUAGAACCGAAUUUGU
774 picture button
xtr-miR-15c miR-15 Xenopus tropicalis
UAGCAGCACAUCAUGGUUUGUA
712 picture button
xtr-miR-15b miR-15 Xenopus tropicalis
UAGCAGCACAUCAUGAUUUGCA
691 picture button
xtr-miR-15a miR-15 Xenopus tropicalis
UAGCAGCACAUAAUGGUUUGUG
755 picture button
xtr-miR-16a miR-16 Xenopus tropicalis
UAGCAGCACGUAAAUAUUGGUG
656 picture button
xtr-miR-16c miR-16 Xenopus tropicalis
UAGCAGCACGUAAAUACUGGAG
602 picture button
xtr-miR-16b miR-16 Xenopus tropicalis
UAGCAGCACGUAAAUAUUGGGU
619 picture button
xtr-miR-17-3p miR-17 Xenopus tropicalis
ACUGCAGUGAAGGCACUUGU
734 picture button
xtr-miR-17-5p miR-17 Xenopus tropicalis
CAAAGUGCUUACAGUGCAGGUAGU
764 picture button
xtr-miR-18b miR-18 Xenopus tropicalis
UAAGGUGCAUCUAGUGCAGUUAG
659 picture button
xtr-miR-18a miR-18 Xenopus tropicalis
UAAGGUGCAUCUAGUGCAGAUA
694 picture button
xtr-miR-19a miR-19 Xenopus tropicalis
UGUGCAAAUCUAUGCAAAACUGA
670 picture button
xtr-miR-19b miR-19 Xenopus tropicalis
UGUGCAAAUCCAUGCAAAACUGA
660 picture button
xtr-miR-20a* miR-20* Xenopus tropicalis
ACUGCAUAAUGAGCACUUAAA
596 picture button
xtr-miR-20b miR-20 Xenopus tropicalis
CAAAGUGCUCAUAGUGCAGGUAG
738 picture button
xtr-miR-20a miR-20 Xenopus tropicalis
UAAAGUGCUUAUAGUGCAGGUAG
730 picture button
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
692 picture button
xtr-miR-22* miR-22* Xenopus tropicalis
AGUUCUUCAGUGGCAAGCUUU
544 picture button
xtr-miR-22 miR-22 Xenopus tropicalis
AAGCUGCCAGUUGAAGAACUGU
717 picture button
xtr-miR-23a miR-23 Xenopus tropicalis
AUCACAUUGCCAGGGAUUUCC
726 picture button
xtr-miR-23b miR-23 Xenopus tropicalis
AUCACAUUGCCAGGGAUUACC
715 picture button
xtr-miR-24b miR-24 Xenopus tropicalis
UGGCUCAGUUCAGCAGGACAG
702 picture button
xtr-miR-24a miR-24 Xenopus tropicalis
UGGCUCAGUUCAGCAGGAACAG
678 picture button
xtr-miR-25 miR-25 Xenopus tropicalis
CAUUGCACUUGUCUCGGUCUGA
750 picture button
xtr-miR-26 miR-26 Xenopus tropicalis
UUCAAGUAAUCCAGGAUAGGC
698 picture button
xtr-miR-27a miR-27 Xenopus tropicalis
UUCACAGUGGCUAAGUUCCGC
722 picture button
xtr-miR-27c miR-27 Xenopus tropicalis
UUCACAGUGGCUAAGUUCCAC
751 picture button
xtr-miR-27b miR-27 Xenopus tropicalis
UUCACAGUGGCUAAGUUCUGC
727 picture button
xtr-miR-29c miR-29 Xenopus tropicalis
UAGCACCAUUUGAAAUCGGU
881 picture button
xtr-miR-29c* miR-29* Xenopus tropicalis
UGACCGAUCUCUCUUGGUGUUC
674 picture button
xtr-miR-29b miR-29 Xenopus tropicalis
UAGCACCAUUUGAAAUCAGUGUU
847 picture button
xtr-miR-29d miR-29 Xenopus tropicalis
UAGCACCAUAUGAAAUCAGUGUC
832 picture button
xtr-miR-29a miR-29 Xenopus tropicalis
UAGCACCAUUUGAAAUCGGUU
847 picture button
xtr-miR-30a-3p miR-30 Xenopus tropicalis
CUUUCAGUCAGAUGUUUGCAGC
642 picture button
xtr-miR-30e miR-30 Xenopus tropicalis
UGUAAACAUCCUUGACUGGA
762 picture button
xtr-miR-30b miR-30 Xenopus tropicalis
UGUAAACAUCCUACACUCAGCU
734 picture button
xtr-miR-30d miR-30 Xenopus tropicalis
UGUAAACAUCCCCGACUGGAAG
701 picture button
xtr-miR-30a-5p miR-30 Xenopus tropicalis
UGUAAACAUCCUCGACUGGAAG
757 picture button
xtr-miR-30c miR-30 Xenopus tropicalis
UGUAAACAUCCUACACUCUCAGC
724 picture button
xtr-miR-31 miR-31 Xenopus tropicalis
AGGCAAGAUGUUGGCAUAGCUG
649 picture button
xtr-miR-33b miR-33 Xenopus tropicalis
GUGCAUUGUUGUUGCAUUG
610 picture button
xtr-miR-33a miR-33 Xenopus tropicalis
GUGCAUUGUAGUUGCAUUG
608 picture button
xtr-miR-34b miR-34 Xenopus tropicalis
CAGGCAGUGUAGUUAGCUGAUUG
703 picture button
xtr-miR-34a miR-34 Xenopus tropicalis
UGGCAGUGUCUUAGCUGGUUGUU
705 picture button
xtr-miR-92b miR-92 Xenopus tropicalis
UAUUGCACUCGUCCCGGCCUC
730 picture button
xtr-miR-92a miR-92 Xenopus tropicalis
UAUUGCACUUGUCCCGGCCUG
750 picture button
xtr-miR-93b miR-93 Xenopus tropicalis
UCAAGUGCUGUUCGUGCAGGUAG
740 picture button
xtr-miR-93a miR-93 Xenopus tropicalis
CAAAGUGCUGUUCGUGCAGGUAG
763 picture button
xtr-miR-96 miR-96 Xenopus tropicalis
UUUGGCACUAGCACAUUUUUGCU
772 picture button
xtr-miR-98 miR-98 Xenopus tropicalis
UGAGGUAGUAAGUUGUAUUGUU
603 picture button
xtr-miR-99 miR-99 Xenopus tropicalis
AACCCGUAGAUCCGAUCUUGUG
754 picture button
xtr-miR-100 miR-100 Xenopus tropicalis
AACCCGUAGAUCCGAACUUGUG
713 picture button
xtr-miR-101a miR-101 Xenopus tropicalis
UACAGUACUGUGAUAACUGAAG
780 picture button
xtr-miR-103 miR-103 Xenopus tropicalis
AGCAGCAUUGUACAGGGCUAUGA
566 picture button
xtr-miR-106 miR-106 Xenopus tropicalis
AAAAGUGCUUAUAGUGCAGGUAGA
657 picture button
xtr-miR-107 miR-107 Xenopus tropicalis
AGCAGCAUUGUACAGGGCUAUCA
576 picture button
xtr-miR-122 miR-122 Xenopus tropicalis
UGGAGUGUGACAAUGGUGUUUGU
579 picture button
xtr-miR-124 miR-124 Xenopus tropicalis
UUAAGGCACGCGGUGAAUGCCA
612 picture button
xtr-miR-125b miR-125 Xenopus tropicalis
UCCCUGAGACCCUAACUUGUGA
776 picture button
xtr-miR-125a miR-125 Xenopus tropicalis
UCCCUGAGACCCUUAACCUGUG
826 picture button
xtr-miR-126* miR-126* Xenopus tropicalis
CAUUAUUACUUUUGGUACGCG
418 picture button
xtr-miR-126 miR-126 Xenopus tropicalis
UCGUACCGUGAGUAAUAAUGC
648 picture button
xtr-miR-128 miR-128 Xenopus tropicalis
UCACAGUGAACCGGUCUCUUUU
653 picture button
xtr-miR-129 miR-129 Xenopus tropicalis
CUUUUUGCGGUCUGGGCUUGC
494 picture button
xtr-miR-130a miR-130 Xenopus tropicalis
CAGUGCAAUGUUAAAAGGGCAU
707 picture button
xtr-miR-130c miR-130 Xenopus tropicalis
CAGUGCAAUAUUAAAAGGGCAU
674 picture button
xtr-miR-130b miR-130 Xenopus tropicalis
CAGUGCAAUGAUGAAAGGGCAU
662 picture button
xtr-miR-132 miR-132 Xenopus tropicalis
UAACAGUCUACAGCCAUGGUCG
786 picture button
xtr-miR-133b miR-133 Xenopus tropicalis
UUGGUCCCCUUCAACCAGCUA
668 picture button
xtr-miR-133d miR-133 Xenopus tropicalis
UUGGUCCCCUUCAACCAGCCGC
673 picture button
xtr-miR-133a miR-133 Xenopus tropicalis
UUGGUCCCCUUCAACCAGCUGU
665 picture button
xtr-miR-133c miR-133 Xenopus tropicalis
UUGGUCCCCUUCAACCAGCUGC
671 picture button
xtr-miR-135 miR-135 Xenopus tropicalis
UAUGGCUUUUUAUUCCUAUGUGA
725 picture button
xtr-miR-137 miR-137 Xenopus tropicalis
UAUUGCUUAAGAAUACGCGUAG
611 picture button
xtr-miR-138 miR-138 Xenopus tropicalis
AGCUGGUGUUGUGAAUC
580 picture button
xtr-miR-139 miR-139 Xenopus tropicalis
UCUACAGUGCAUGUGUCU
637 picture button
xtr-miR-140 miR-140 Xenopus tropicalis
AGUGGUUUUACCCUAUGGUAG
585 picture button
dre-miR-141 miR-141 Danio rerio
UAACACUGUCUGGUAACGAUGC
851 picture button
xtr-miR-142-5p miR-142 Xenopus tropicalis
CAUAAAGUAGAAAGCACUAC
461 picture button
xtr-miR-142-3p miR-142 Xenopus tropicalis
UGUAGUGUUUCCUACUUUAUGGA
603 picture button
xtr-miR-143 miR-143 Xenopus tropicalis
UGAGAUGAAGCACUGUAGCUCG
605 picture button
xtr-miR-144 miR-144 Xenopus tropicalis
UACAGUAUAGAUGAUGUACUA
608 picture button
xtr-miR-145 miR-145 Xenopus tropicalis
GUCCAGUUUUCCCAGGAAUCCCUU
655 picture button

Page 1 of 2
1 2 next >>

spacer
spacer