spacer

MicroRNA Listing for Mus musculus


793 microRNAs (568 native)


Page 1 of 8
1 2 3 4 5 6 7 8 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-let-7d let-7 Mus musculus
AGAGGUAGUAGGUUGCAUAGUU
978 picture button
mmu-let-7d* let-7* Mus musculus
CUAUACGACCUGCUGCCUUUCU
972 picture button
mmu-let-7a let-7 Mus musculus
UGAGGUAGUAGGUUGUAUAGUU
951 picture button
mmu-let-7a* let-7* Mus musculus
CUAUACAAUCUACUGUCUUUCC
953 picture button
mmu-let-7f let-7 Mus musculus
UGAGGUAGUAGAUUGUAUAGUU
918 picture button
mmu-let-7g* let-7* Mus musculus
ACUGUACAGGCCACUGCCUUGC
1021 picture button
mmu-let-7c let-7 Mus musculus
UGAGGUAGUAGGUUGUAUGGUU
1016 picture button
mmu-let-7c-1* let-7* Mus musculus
CUGUACAACCUUCUAGCUUUCC
1098 picture button
mmu-let-7i let-7 Mus musculus
UGAGGUAGUAGUUUGUGCUGUU
1034 picture button
mmu-let-7e let-7 Mus musculus
UGAGGUAGGAGGUUGUAUAGUU
952 picture button
mmu-let-7f* let-7* Mus musculus
CUAUACAAUCUAUUGCCUUCCC
985 picture button
mmu-let-7b let-7 Mus musculus
UGAGGUAGUAGGUUGUGUGGUU
1012 picture button
mmu-let-7b* let-7* Mus musculus
CUAUACAACCUACUGCCUUCCC
957 picture button
mmu-let-7g let-7 Mus musculus
UGAGGUAGUAGUUUGUACAGUU
981 picture button
mmu-let-7i* let-7* Mus musculus
CUGCGCAAGCUACUGCCUUGCU
972 picture button
mmu-miR-1 miR-1 Mus musculus
UGGAAUGUAAAGAAGUAUGUAU
857 picture button
mmu-miR-7a miR-7 Mus musculus
UGGAAGACUAGUGAUUUUGUUGU
923 picture button
mmu-miR-7a* miR-7* Mus musculus
CAACAAAUCACAGUCUGCCAUA
722 picture button
mmu-miR-7b miR-7 Mus musculus
UGGAAGACUUGUGAUUUUGUUGU
902 picture button
mmu-miR-9* miR-9* Mus musculus
AUAAAGCUAGAUAACCGAAAGU
734 picture button
mmu-miR-9 miR-9 Mus musculus
UCUUUGGUUAUCUAGCUGUAUGA
905 picture button
mmu-miR-10b* miR-10* Mus musculus
CAGAUUCGAUUCUAGGGGAAUA
773 picture button
mmu-miR-10a miR-10 Mus musculus
UACCCUGUAGAUCCGAAUUUGUG
872 picture button
mmu-miR-10a* miR-10* Mus musculus
CAAAUUCGUAUCUAGGGGAAUA
693 picture button
mmu-miR-10b miR-10 Mus musculus
UACCCUGUAGAACCGAAUUUGUG
850 picture button
mmu-miR-15a* miR-15* Mus musculus
CAGGCCAUACUGUGCUGCCUCA
751 picture button
mmu-miR-15b miR-15 Mus musculus
UAGCAGCACAUCAUGGUUUACA
977 picture button
mmu-miR-15b* miR-15* Mus musculus
CGAAUCAUUAUUUGCUGCUCUA
718 picture button
mmu-miR-15a miR-15 Mus musculus
UAGCAGCACAUAAUGGUUUGUG
953 picture button
mmu-miR-16* miR-16* Mus musculus
CCAGUAUUGACUGUGCUGCUGA
710 picture button
mmu-miR-16 miR-16 Mus musculus
UAGCAGCACGUAAAUAUUGGCG
921 picture button
mmu-miR-17 miR-17 Mus musculus
CAAAGUGCUUACAGUGCAGGUAG
1040 picture button
mmu-miR-17* miR-17* Mus musculus
ACUGCAGUGAGGGCACUUGUAG
770 picture button
mmu-miR-18b miR-18 Mus musculus
UAAGGUGCAUCUAGUGCUGUUAG
958 picture button
mmu-miR-18a miR-18 Mus musculus
UAAGGUGCAUCUAGUGCAGAUAG
991 picture button
mmu-miR-18a* miR-18* Mus musculus
ACUGCCCUAAGUGCUCCUUCUG
668 picture button
mmu-miR-19a* miR-19* Mus musculus
UAGUUUUGCAUAGUUGCACUAC
654 picture button
mmu-miR-19b miR-19 Mus musculus
UGUGCAAAUCCAUGCAAAACUGA
904 picture button
mmu-miR-19a miR-19 Mus musculus
UGUGCAAAUCUAUGCAAAACUGA
933 picture button
mmu-miR-20a miR-20 Mus musculus
UAAAGUGCUUAUAGUGCAGGUAG
998 picture button
mmu-miR-20a* miR-20* Mus musculus
ACUGCAUUACGAGCACUUAAAG
762 picture button
mmu-miR-20b miR-20 Mus musculus
CAAAGUGCUCAUAGUGCAGGUAG
991 picture button
mmu-miR-20b* miR-20* Mus musculus
ACUGCAGUGUGAGCACUUCUAG
778 picture button
mmu-miR-21 miR-21 Mus musculus
UAGCUUAUCAGACUGAUGUUGA
836 picture button
mmu-miR-21* miR-21* Mus musculus
CAACAGCAGUCGAUGGGCUGUC
819 picture button
mmu-miR-22* miR-22* Mus musculus
AGUUCUUCAGUGGCAAGCUUUA
767 picture button
mmu-miR-22 miR-22 Mus musculus
AAGCUGCCAGUUGAAGAACUGU
983 picture button
mmu-miR-23b miR-23 Mus musculus
AUCACAUUGCCAGGGAUUACC
921 picture button
mmu-miR-23a miR-23 Mus musculus
AUCACAUUGCCAGGGAUUUCC
917 picture button
mmu-miR-24 miR-24 Mus musculus
UGGCUCAGUUCAGCAGGAACAG
885 picture button
mmu-miR-24-2* miR-24* Mus musculus
GUGCCUACUGAGCUGAAACAGU
793 picture button
mmu-miR-24-1* miR-24* Mus musculus
GUGCCUACUGAGCUGAUAUCAGU
787 picture button
mmu-miR-25 miR-25 Mus musculus
CAUUGCACUUGUCUCGGUCUGA
1031 picture button
mmu-miR-26b miR-26 Mus musculus
UUCAAGUAAUUCAGGAUAGGU
898 picture button
mmu-miR-26a miR-26 Mus musculus
UUCAAGUAAUCCAGGAUAGGCU
902 picture button
mmu-miR-26b* miR-26* Mus musculus
CCUGUUCUCCAUUACUUGGCUC
672 picture button
mmu-miR-27b miR-27 Mus musculus
UUCACAGUGGCUAAGUUCUGC
953 picture button
mmu-miR-27b* miR-27* Mus musculus
AGAGCUUAGCUGAUUGGUGAAC
752 picture button
mmu-miR-27a miR-27 Mus musculus
UUCACAGUGGCUAAGUUCCGC
912 picture button
mmu-miR-27a* miR-27* Mus musculus
AGGGCUUAGCUGCUUGUGAGCA
765 picture button
mmu-miR-28 miR-28 Mus musculus
AAGGAGCUCACAGUCUAUUGAG
822 picture button
mmu-miR-28* miR-28* Mus musculus
CACUAGAUUGUGAGCUGCUGGA
697 picture button
mmu-miR-29a* miR-29* Mus musculus
ACUGAUUUCUUUUGGUGUUCAG
886 picture button
mmu-miR-29a miR-29 Mus musculus
UAGCACCAUCUGAAAUCGGUUA
1164 picture button
mmu-miR-29c* miR-29* Mus musculus
UGACCGAUUUCUCCUGGUGUUC
847 picture button
mmu-miR-29c miR-29 Mus musculus
UAGCACCAUUUGAAAUCGGUUA
1155 picture button
mmu-miR-29b* miR-29* Mus musculus
GCUGGUUUCAUAUGGUGGUUUA
852 picture button
mmu-miR-29b miR-29 Mus musculus
UAGCACCAUUUGAAAUCAGUGUU
1111 picture button
mmu-miR-30b miR-30 Mus musculus
UGUAAACAUCCUACACUCAGCU
997 picture button
mmu-miR-30e* miR-30* Mus musculus
CUUUCAGUCGGAUGUUUACAGC
892 picture button
mmu-miR-30b* miR-30* Mus musculus
CUGGGAUGUGGAUGUUUACGUC
916 picture button
mmu-miR-30d miR-30 Mus musculus
UGUAAACAUCCCCGACUGGAAG
973 picture button
mmu-miR-30a miR-30 Mus musculus
UGUAAACAUCCUCGACUGGAAG
979 picture button
mmu-miR-30c-2* miR-30* Mus musculus
CUGGGAGAAGGCUGUUUACUCU
934 picture button
mmu-miR-30a* miR-30* Mus musculus
CUUUCAGUCGGAUGUUUGCAGC
901 picture button
mmu-miR-30c miR-30 Mus musculus
UGUAAACAUCCUACACUCUCAGC
987 picture button
mmu-miR-30c-1* miR-30* Mus musculus
CUGGGAGAGGGUUGUUUACUCC
913 picture button
mmu-miR-30e miR-30 Mus musculus
UGUAAACAUCCUUGACUGGAAG
1004 picture button
mmu-miR-31* miR-31* Mus musculus
UGCUAUGCCAACAUAUUGCCAUC
698 picture button
mmu-miR-31 miR-31 Mus musculus
AGGCAAGAUGCUGGCAUAGCUG
892 picture button
mmu-miR-32 miR-32 Mus musculus
UAUUGCACAUUACUAAGUUGCA
988 picture button
mmu-miR-33* miR-33* Mus musculus
CAAUGUUUCCACAGUGCAUCAC
578 picture button
mmu-miR-33 miR-33 Mus musculus
GUGCAUUGUAGUUGCAUUGCA
893 picture button
mmu-miR-34c* miR-34* Mus musculus
AAUCACUAACCACACAGCCAGG
735 picture button
mmu-miR-34b-3p miR-34 Mus musculus
AAUCACUAACUCCACUGCCAUC
940 picture button
mmu-miR-34c miR-34 Mus musculus
AGGCAGUGUAGUUAGCUGAUUGC
979 picture button
mmu-miR-34a miR-34 Mus musculus
UGGCAGUGUCUUAGCUGGUUGU
1079 picture button
mmu-miR-34b-5p miR-34 Mus musculus
AGGCAGUGUAAUUAGCUGAUUGU
1029 picture button
mmu-miR-92a* miR-92* Mus musculus
AGGUGGGGAUUGGUGGCAUUAC
699 picture button
mmu-miR-92b miR-92 Mus musculus
UAUUGCACUCGUCCCGGCCUCC
1008 picture button
mmu-miR-92a miR-92 Mus musculus
UAUUGCACUUGUCCCGGCCUG
1031 picture button
mmu-miR-93* miR-93* Mus musculus
ACUGCUGAGCUAGCACUUCCCG
802 picture button
mmu-miR-93 miR-93 Mus musculus
CAAAGUGCUGUUCGUGCAGGUAG
961 picture button
hsa-miR-95 miR-95 Homo sapiens
UUCAACGGGUAUUUAUUGAGCA
867 picture button
mmu-miR-96 miR-96 Mus musculus
UUUGGCACUAGCACAUUUUUGCU
948 picture button
mmu-miR-98 miR-98 Mus musculus
UGAGGUAGUAAGUUGUAUUGUU
844 picture button
mmu-miR-99b miR-99 Mus musculus
CACCCGUAGAACCGACCUUGCG
904 picture button
mmu-miR-99a miR-99 Mus musculus
AACCCGUAGAUCCGAUCUUGUG
943 picture button
mmu-miR-99b* miR-99* Mus musculus
CAAGCUCGUGUCUGUGGGUCCG
752 picture button
mmu-miR-100 miR-100 Mus musculus
AACCCGUAGAUCCGAACUUGUG
895 picture button

Page 1 of 8
1 2 3 4 5 6 7 8 next >>

spacer
spacer