spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-351 miR-351 Mus musculus
UCCCUGAGGAGCCCUUUGAGCCUG
970 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
716 picture button
hsa-miR-361-5p miR-361 Homo sapiens
UUAUCAGAAUCUCCAGGGGUAC
977 picture button
hsa-miR-361-3p miR-361 Homo sapiens
UCCCCCAGGUGUGAUUCUGAUUU
912 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
1042 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
971 picture button
hsa-miR-363 miR-363 Homo sapiens
AAUUGCACGGUAUCCAUCUGUA
890 picture button
hsa-miR-365 miR-365 Homo sapiens
UAAUGCCCCUAAAAAUCCUUAU
1038 picture button
hsa-miR-367 miR-367 Homo sapiens
AAUUGCACUUUAGCAAUGGUGA
1473 picture button
hsa-miR-369-3p miR-369 Homo sapiens
AAUAAUACAUGGUUGAUCUUU
926 picture button
hsa-miR-369-5p miR-369 Homo sapiens
AGAUCGACCGUGUUAUAUUCGC
1006 picture button
hsa-miR-370 miR-370 Homo sapiens
GCCUGCUGGGGUGGAACCUGGU
1033 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
1174 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
1073 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
955 picture button
hsa-miR-373 miR-373 Homo sapiens
GAAGUGCUUCGAUUUUGGGGUGU
1143 picture button
hsa-miR-374b miR-374 Homo sapiens
AUAUAAUACAACCUGCUAAGUG
651 picture button
hsa-miR-374a miR-374 Homo sapiens
UUAUAAUACAACCUGAUAAGUG
654 picture button
hsa-miR-375 miR-375 Homo sapiens
UUUGUUCGUUCGGCUCGCGUGA
876 picture button
hsa-miR-376a miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCACGU
979 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
966 picture button
hsa-miR-376b miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCAUGUU
982 picture button
hsa-miR-377 miR-377 Homo sapiens
AUCACACAAAGGCAACUUUUGU
943 picture button
hsa-miR-378 miR-378 Homo sapiens
ACUGGACUUGGAGUCAGAAGG
986 picture button
hsa-miR-379 miR-379 Homo sapiens
UGGUAGACUAUGGAACGUAGG
962 picture button
hsa-miR-380 miR-380 Homo sapiens
UAUGUAAUAUGGUCCACAUCUU
776 picture button
hsa-miR-381 miR-381 Homo sapiens
UAUACAAGGGCAAGCUCUCUGU
790 picture button
hsa-miR-382 miR-382 Homo sapiens
GAAGUUGUUCGUGGUGGAUUCG
868 picture button
hsa-miR-383 miR-383 Homo sapiens
AGAUCAGAAGGUGAUUGUGGCU
993 picture button
hsa-miR-384 miR-384 Homo sapiens
AUUCCUAGAAAUUGUUCAUA
886 picture button
hsa-miR-409-3p miR-409 Homo sapiens
GAAUGUUGCUCGGUGAACCCCU
879 picture button
hsa-miR-409-5p miR-409 Homo sapiens
AGGUUACCCGAGCAACUUUGCAU
1014 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
808 picture button
hsa-miR-411 miR-411 Homo sapiens
UAGUAGACCGUAUAGCGUACG
927 picture button
hsa-miR-412 miR-412 Homo sapiens
ACUUCACCUGGUCCACUAGCCGU
846 picture button
hsa-miR-421 miR-421 Homo sapiens
AUCAACAGACAUUAAUUGGGCGC
1004 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
978 picture button
hsa-miR-423-5p miR-423 Homo sapiens
UGAGGGGCAGAGAGCGAGACUUU
904 picture button
hsa-miR-423-3p miR-423 Homo sapiens
AGCUCGGUCUGAGGCCCCUCAGU
996 picture button
hsa-miR-424 miR-424 Homo sapiens
CAGCAGCAAUUCAUGUUUUGAA
1059 picture button
hsa-miR-425 miR-425 Homo sapiens
AAUGACACGAUCACUCCCGUUGA
989 picture button
hsa-miR-429 miR-429 Homo sapiens
UAAUACUGUCUGGUAAAACCGU
1051 picture button
hsa-miR-431 miR-431 Homo sapiens
UGUCUUGCAGGCCGUCAUGCA
901 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
881 picture button
hsa-miR-433 miR-433 Homo sapiens
AUCAUGAUGGGCUCCUCGGUGU
1013 picture button
mmu-miR-434-5p miR-434 Mus musculus
GCUCGACUCAUGGUUUGAACCA
972 picture button
mmu-miR-434-3p miR-434 Mus musculus
UUUGAACCAUCACUCGACUCCU
979 picture button
hsa-miR-448 miR-448 Homo sapiens
UUGCAUAUGUAGGAUGUCCCAU
874 picture button
hsa-miR-449b miR-449 Homo sapiens
AGGCAGUGUAUUGUUAGCUGGC
1018 picture button
hsa-miR-449a miR-449 Homo sapiens
UGGCAGUGUAUUGUUAGCUGGU
1004 picture button
hsa-miR-450b-3p miR-450 Homo sapiens
UUGGGAUCAUUUUGCAUCCAUA
938 picture button
hsa-miR-450a miR-450 Homo sapiens
UUUUGCGAUGUGUUCCUAAUAU
998 picture button
hsa-miR-450b-5p miR-450 Homo sapiens
UUUUGCAAUAUGUUCCUGAAUA
1022 picture button
hsa-miR-451 miR-451 Homo sapiens
AAACCGUUACCAUUACUGAGUU
993 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
868 picture button
hsa-miR-453 miR-453 Homo sapiens
AGGUUGUCCGUGGUGAGUUCGCA
945 picture button
hsa-miR-454 miR-454 Homo sapiens
UAGUGCAAUAUUGCUUAUAGGGU
977 picture button
hsa-miR-455-3p miR-455 Homo sapiens
GCAGUCCAUGGGCAUAUACAC
1104 picture button
hsa-miR-455-5p miR-455 Homo sapiens
UAUGUGCCUUUGGACUACAUCG
1003 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
719 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
873 picture button
mmu-miR-463 miR-463 Mus musculus
UGAUAGACACCAUAUAAGGUAG
936 picture button
mmu-miR-464 miR-464 Mus musculus
UACCAAGUUUAUUCUGUGAGAUA
1002 picture button
mmu-miR-465b-5p miR-465 Mus musculus
UAUUUAGAAUGGUGCUGAUCUG
887 picture button
mmu-miR-465a-5p miR-465 Mus musculus
UAUUUAGAAUGGCACUGAUGUGA
907 picture button
mmu-miR-465c-5p miR-465 Mus musculus
UAUUUAGAAUGGCGCUGAUCUG
924 picture button
mmu-miR-465a-3p miR-465 Mus musculus
GAUCAGGGCCUUUCUAAGUAGA
1022 picture button
mmu-miR-466d-5p miR-466 Mus musculus
UGUGUGUGCGUACAUGUACAUG
1385 picture button
mmu-miR-466b-5p miR-466 Mus musculus
GAUGUGUGUGUACAUGUACAUG
1295 picture button
mmu-miR-466h miR-466 Mus musculus
UGUGUGCAUGUGCUUGUGUGUA
1321 picture button
mmu-miR-466a-3p miR-466 Mus musculus
UAUACAUACACGCACACAUAAGA
1285 picture button
mmu-miR-466f-3p miR-466 Mus musculus
CAUACACACACACAUACACAC
1475 picture button
mmu-miR-466d-3p miR-466 Mus musculus
UAUACAUACACGCACACAUAG
1291 picture button
mmu-miR-466b-3-3p miR-466 Mus musculus
AAUACAUACACGCACACAUAAGA
1258 picture button
mmu-miR-466g miR-466 Mus musculus
AUACAGACACAUGCACACACA
1422 picture button
mmu-miR-466e-5p miR-466 Mus musculus
GAUGUGUGUGUACAUGUACAUA
1300 picture button
mmu-miR-466c-5p miR-466 Mus musculus
GAUGUGUGUGUGCAUGUACAUA
1289 picture button
mmu-miR-466a-5p miR-466 Mus musculus
UAUGUGUGUGUACAUGUACAUA
1326 picture button
mmu-miR-466f-5p miR-466 Mus musculus
UACGUGUGUGUGCAUGUGCAUG
1414 picture button
mmu-miR-467c miR-467 Mus musculus
UAAGUGCGUGCAUGUAUAUGUG
1038 picture button
mmu-miR-467e miR-467 Mus musculus
AUAAGUGUGAGCAUGUAUAUGU
990 picture button
mmu-miR-467b miR-467 Mus musculus
GUAAGUGCCUGCAUGUAUAUG
1075 picture button
mmu-miR-467d miR-467 Mus musculus
UAAGUGCGCGCAUGUAUAUGCG
1028 picture button
mmu-miR-467a miR-467 Mus musculus
UAAGUGCCUGCAUGUAUAUGCG
1136 picture button
mmu-miR-468 miR-468 Mus musculus
UAUGACUGAUGUGCGUGUGUCUG
917 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
765 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
860 picture button
mmu-miR-471 miR-471 Mus musculus
UACGUAGUAUAGUGCUUUUCAC
932 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
940 picture button
hsa-miR-483-3p miR-483 Homo sapiens
UCACUCCUCUCCUCCCGUCUU
938 picture button
hsa-miR-484 miR-484 Homo sapiens
UCAGGCUCAGUCCCCUCCCGAU
921 picture button
hsa-miR-485-3p miR-485 Homo sapiens
GUCAUACACGGCUCUCCUCUCU
1005 picture button
hsa-miR-485-5p miR-485 Homo sapiens
AGAGGCUGGCCGUGAUGAAUUC
679 picture button
hsa-miR-486-5p miR-486 Homo sapiens
UCCUGUACUGAGCUGCCCCGAG
1040 picture button
hsa-miR-486-3p miR-486 Homo sapiens
CGGGGCAGCUCAGUACAGGAU
903 picture button
hsa-miR-487b miR-487 Homo sapiens
AAUCGUACAGGGUCAUCCACUU
991 picture button
hsa-miR-487a miR-487 Homo sapiens
AAUCAUACAGGGACAUCCAGUU
1008 picture button
hsa-miR-488 miR-488 Homo sapiens
UUGAAAGGCUAUUUCUUGGUC
831 picture button
hsa-miR-489 miR-489 Homo sapiens
GUGACAUCACAUAUACGGCAGC
1024 picture button
hsa-miR-490-3p miR-490 Homo sapiens
CAACCUGGAGGACUCCAUGCUG
865 picture button

Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer