spacer

MicroRNA Listing for Macaca mulatta


656 microRNAs (70 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
1016 picture button
hsa-miR-553 miR-553 Homo sapiens
AAAACGGUGAGAUUUUGUUUU
955 picture button
hsa-miR-320 miR-320 Homo sapiens
AAAAGCUGGGUUGAGAGGGCGA
1000 picture button
hsa-miR-548a-5p miR-548 Homo sapiens
AAAAGUAAUUGCGAGUUUUACC
936 picture button
hsa-miR-548c-5p miR-548 Homo sapiens
AAAAGUAAUUGCGGUUUUUGCC
996 picture button
hsa-miR-548b-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUGGCC
982 picture button
hsa-miR-548d-5p miR-548 Homo sapiens
AAAAGUAAUUGUGGUUUUUGCC
999 picture button
mml-miR-106a miR-106 Macaca mulatta
AAAAGUGCUUACAGUGCAGGUAGC
1233 picture button
hsa-miR-522 miR-522 Homo sapiens
AAAAUGGUUCCCUUUAGAGUGU
841 picture button
hsa-miR-495 miR-495 Homo sapiens
AAACAAACAUGGUGCACUUCUU
1005 picture button
hsa-miR-543 miR-543 Homo sapiens
AAACAUUCGCGGUGCACUUCUU
1072 picture button
hsa-miR-451 miR-451 Homo sapiens
AAACCGUUACCAUUACUGAGUU
993 picture button
hsa-miR-649 miR-649 Homo sapiens
AAACCUGUGUUGUUCAAGAGUC
1007 picture button
hsa-miR-606 miR-606 Homo sapiens
AAACUACUGAAAAUCAAAGAU
833 picture button
hsa-miR-618 miR-618 Homo sapiens
AAACUCUACUUGUCCUUCUGAGU
967 picture button
hsa-miR-641 miR-641 Homo sapiens
AAAGACAUAGGAUAGAGUCACCUC
822 picture button
hsa-miR-518e miR-518 Homo sapiens
AAAGCGCUUCCCUUCAGAGUG
1269 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
873 picture button
hsa-miR-562 miR-562 Homo sapiens
AAAGUAGCUGUACCAUUUGC
875 picture button
mmu-miR-291b-3p miR-291 Mus musculus
AAAGUGCAUCCAUUUUGUUUGU
1185 picture button
hsa-miR-519b-3p miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGGUU
1198 picture button
hsa-miR-519a miR-519 Homo sapiens
AAAGUGCAUCCUUUUAGAGUGU
1224 picture button
hsa-miR-519c-3p miR-519 Homo sapiens
AAAGUGCAUCUUUUUAGAGGAU
1241 picture button
mmu-miR-292-3p miR-292 Mus musculus
AAAGUGCCGCCAGGUUUUGAGUGU
1104 picture button
mmu-miR-290-3p miR-290 Mus musculus
AAAGUGCCGCCUAGUUUUAAGCCC
1098 picture button
mmu-miR-295 miR-295 Mus musculus
AAAGUGCUACUACUUUUGAGUCU
694 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
955 picture button
mml-miR-93 miR-93 Macaca mulatta
AAAGUGCUGUUCGUGCAGGUAG
1247 picture button
mmu-miR-291a-3p miR-291 Mus musculus
AAAGUGCUUCCACUUUGUGUGC
994 picture button
hsa-miR-520a-3p miR-520 Homo sapiens
AAAGUGCUUCCCUUUGGACUGU
1007 picture button
mmu-miR-294 miR-294 Mus musculus
AAAGUGCUUCCCUUUUGUGUGU
873 picture button
hsa-miR-520b miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGG
1046 picture button
hsa-miR-520c-3p miR-520 Homo sapiens
AAAGUGCUUCCUUUUAGAGGGU
1057 picture button
hsa-miR-520e miR-520 Homo sapiens
AAAGUGCUUCCUUUUUGAGGG
1044 picture button
hsa-miR-520d-3p miR-520 Homo sapiens
AAAGUGCUUCUCUUUGGUGGGU
1079 picture button
hsa-miR-216b miR-216 Homo sapiens
AAAUCUCUGCAGGCAAAUGUGA
1044 picture button
hsa-miR-944 miR-944 Homo sapiens
AAAUUAUUGUACAUCGGAUGAG
691 picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
1021 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
971 picture button
hsa-miR-329 miR-329 Homo sapiens
AACACACCUGGUUAACCUCUUU
924 picture button
mml-miR-141 miR-141 Macaca mulatta
AACACUGUCUGGUAAAGAUGG
974 picture button
hsa-miR-552 miR-552 Homo sapiens
AACAGGUGACUGGUUAGACAA
843 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
966 picture button
hsa-miR-499-3p miR-499 Homo sapiens
AACAUCACAGCAAGUCUGUGCU
971 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
991 picture button
mml-miR-181c miR-181 Macaca mulatta
AACAUUCAACCUGUCGGUGAGU
1177 picture button
mml-miR-181a miR-181 Macaca mulatta
AACAUUCAACGCUGUCGGUGAGU
1181 picture button
mml-miR-181b miR-181 Macaca mulatta
AACAUUCAUUGCUGUCGGUGGGUU
1188 picture button
hsa-miR-634 miR-634 Homo sapiens
AACCAGCACCCCAACUUUGGAC
933 picture button
mml-miR-100 miR-100 Macaca mulatta
AACCCGUAGAUCCGAACUUGUG
890 picture button
mml-miR-99a miR-99 Macaca mulatta
AACCCGUAGAUCCGAUCUUGUG
943 picture button
hsa-miR-521 miR-521 Homo sapiens
AACGCACUUCCCUUUAGAGUGU
959 picture button
hsa-miR-193b miR-193 Homo sapiens
AACUGGCCCUCAAAGUCCCGCU
950 picture button
hsa-miR-193a-3p miR-193 Homo sapiens
AACUGGCCUACAAAGUCCCAGU
892 picture button
mmu-miR-881 miR-881 Mus musculus
AACUGUGUCUUUUCUGAAUAGA
839 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
868 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
940 picture button
hsa-miR-576-3p miR-576 Homo sapiens
AAGAUGUGGAAAAAUUGGAAUC
943 picture button
hsa-miR-646 miR-646 Homo sapiens
AAGCAGCUGCCUCUGAGGC
1000 picture button
hsa-miR-129-3p miR-129 Homo sapiens
AAGCCCUUACCCCAAAAAGCAU
1022 picture button
hsa-miR-596 miR-596 Homo sapiens
AAGCCUGCCCGGCUCCUCGGG
846 picture button
mml-miR-22 miR-22 Macaca mulatta
AAGCUGCCAGUUGAAGAACUGU
1085 picture button
mml-miR-28 miR-28 Macaca mulatta
AAGGAGCUCACAGUCUAUUGAG
914 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
860 picture button
hsa-miR-940 miR-940 Homo sapiens
AAGGCAGGGCCCCCGCUCCCC
723 picture button
hsa-miR-872 miR-872 Homo sapiens
AAGGUUACUUGUUAGUUCAGG
918 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
1073 picture button
hsa-miR-519e miR-519 Homo sapiens
AAGUGCCUCCUUUUAGAGUGUU
1070 picture button
hsa-miR-512-3p miR-512 Homo sapiens
AAGUGCUGUCAUAGCUGAGGUC
984 picture button
hsa-miR-520f miR-520 Homo sapiens
AAGUGCUUCCUUUUAGAGGGUU
1311 picture button
hsa-miR-648 miR-648 Homo sapiens
AAGUGUGCAGGGCACUGGU
1051 picture button
hsa-miR-369-3p miR-369 Homo sapiens
AAUAAUACAUGGUUGAUCUUU
926 picture button
mmu-miR-466b-3-3p miR-466 Mus musculus
AAUACAUACACGCACACAUAAGA
1258 picture button
mml-miR-200c miR-200 Macaca mulatta
AAUACUGCCGGGUAAUGAUGGA
1136 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
808 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
695 picture button
hsa-miR-487a miR-487 Homo sapiens
AAUCAUACAGGGACAUCCAGUU
1008 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
1042 picture button
hsa-miR-501-5p miR-501 Homo sapiens
AAUCCUUUGUCCCUGGGUGAGA
953 picture button
hsa-miR-487b miR-487 Homo sapiens
AAUCGUACAGGGUCAUCCACUU
991 picture button
hsa-miR-425 miR-425 Homo sapiens
AAUGACACGAUCACUCCCGUUGA
989 picture button
hsa-miR-501-3p miR-501 Homo sapiens
AAUGCACCCGGGCAAGGAUUCU
1056 picture button
hsa-miR-502-3p miR-502 Homo sapiens
AAUGCACCUGGGCAAGGAUUCA
1051 picture button
hsa-miR-652 miR-652 Homo sapiens
AAUGGCGCCACUAGGGUUGUG
1012 picture button
hsa-miR-363 miR-363 Homo sapiens
AAUUGCACGGUAUCCAUCUGUA
890 picture button
hsa-miR-367 miR-367 Homo sapiens
AAUUGCACUUUAGCAAUGGUGA
1473 picture button
hsa-miR-520h miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGU
951 picture button
hsa-miR-520g miR-520 Homo sapiens
ACAAAGUGCUUCCCUUUAGAGUGU
1142 picture button
mml-miR-214 miR-214 Macaca mulatta
ACAGCAGGCACAGACAGGCAG
1040 picture button
hsa-miR-936 miR-936 Homo sapiens
ACAGUAGAGGGAGGAAUCGCAG
882 picture button
hsa-miR-622 miR-622 Homo sapiens
ACAGUCUGCUGAGGUUGGAGC
861 picture button
hsa-miR-665 miR-665 Homo sapiens
ACCAGGAGGCUGAGGCCCCU
899 picture button
mml-miR-181a* miR-181* Macaca mulatta
ACCAUCGACCGUUGAUUGUACC
978 picture button
mmu-miR-290-5p miR-290 Mus musculus
ACUCAAACUAUGGGGGCACUUU
1088 picture button
mmu-miR-292-5p miR-292 Mus musculus
ACUCAAACUGGGGGCUCUUUUG
1196 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
1174 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
695 picture button
hsa-miR-136 miR-136 Homo sapiens
ACUCCAUUUGUUUUGAUGAUGGA
830 picture button
mml-miR-17-3p miR-17 Macaca mulatta
ACUGCAGUGAAGGCACUUGU
1021 picture button
hsa-miR-324-3p miR-324 Homo sapiens
ACUGCCCCAGGUGCUGCUGG
1118 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer