spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-653 miR-653 Homo sapiens
GUGUUGAAACAAUCUCUACUG
517 picture button
hsa-miR-654-5p miR-654 Homo sapiens
UGGUGGGCCGCAGAACAUGUGC
653 picture button
hsa-miR-654-3p miR-654 Homo sapiens
UAUGUCUGCUGACCAUCACCUU
641 picture button
hsa-miR-655 miR-655 Homo sapiens
AUAAUACAUGGUUAACCUCUUU
542 picture button
hsa-miR-656 miR-656 Homo sapiens
AAUAUUAUACAGUCAACCUCU
478 picture button
hsa-miR-657 miR-657 Homo sapiens
GGCAGGUUCUCACCCUCUCUAGG
548 picture button
hsa-miR-658 miR-658 Homo sapiens
GGCGGAGGGAAGUAGGUCCGUUGGU
545 picture button
hsa-miR-659 miR-659 Homo sapiens
CUUGGUUCAGGGAGGGUCCCCA
568 picture button
bta-miR-660 miR-660 Bos taurus
UACCCAUUGCAUAUCGGAGCUG
607 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
509 picture button
hsa-miR-662 miR-662 Homo sapiens
UCCCACGUUGUGGCCCAGCAG
626 picture button
hsa-miR-663 miR-663 Homo sapiens
AGGCGGGGCGCCGCGGGACCGC
626 picture button
rno-miR-664 miR-664 Rattus norvegicus
UAUUCAUUUACUCCCCAGCCUA
501 picture button
hsa-miR-665 miR-665 Homo sapiens
ACCAGGAGGCUGAGGCCCCU
533 picture button
mmu-miR-666-5p miR-666 Mus musculus
AGCGGGCACAGCUGUGAGAGCC
703 picture button
mmu-miR-666-3p miR-666 Mus musculus
GGCUGCAGCGUGAUCGCCUGCU
547 picture button
mmu-miR-667 miR-667 Mus musculus
UGACACCUGCCACCCAGCCCAAG
643 picture button
hsa-miR-668 miR-668 Homo sapiens
UGUCACUCGGCUCGGCCCACUAC
533 picture button
mmu-miR-669b miR-669 Mus musculus
AGUUUUGUGUGCAUGUGCAUGU
611 picture button
mmu-miR-669a miR-669 Mus musculus
AGUUGUGUGUGCAUGUUCAUGU
645 picture button
mmu-miR-669c miR-669 Mus musculus
AUAGUUGUGUGUGGAUGUGUGU
655 picture button
mmu-miR-670 miR-670 Mus musculus
AUCCCUGAGUGUAUGUGGUGAA
629 picture button
hsa-miR-671-5p miR-671 Homo sapiens
AGGAAGCCCUGGAGGGGCUGGAG
654 picture button
hsa-miR-671-3p miR-671 Homo sapiens
UCCGGUUCUCAGGGCUCCACC
659 picture button
hsa-miR-672 miR-672 Homo sapiens
UGAGGUUGGUGUACUGUGUGUGA
520 picture button
mmu-miR-673-5p miR-673 Mus musculus
CUCACAGCUCUGGUCCUUGGAG
674 picture button
mmu-miR-673-3p miR-673 Mus musculus
UCCGGGGCUGAGUUCUGUGCACC
746 picture button
hsa-miR-674 miR-674 Homo sapiens
GCACUGAGAUGGGAGUGGUGUA
614 picture button
hsa-miR-675 miR-675 Homo sapiens
UGGUGCGGAGAGGGCCCACAGUG
559 picture button
mmu-miR-676 miR-676 Mus musculus
CCGUCCUGAGGUUGUUGAGCU
538 picture button
mmu-miR-677 miR-677 Mus musculus
UUCAGUGAUGAUUAGCUUCUGA
583 picture button
mmu-miR-678 miR-678 Mus musculus
GUCUCGGUGCAAGGACUGGAGG
552 picture button
mmu-miR-679 miR-679 Mus musculus
GGACUGUGAGGUGACUCUUGGU
588 picture button
mmu-miR-680 miR-680 Mus musculus
GGGCAUCUGCUGACAUGGGGG
523 picture button
mmu-miR-681 miR-681 Mus musculus
CAGCCUCGCUGGCAGGCAGCU
577 picture button
mmu-miR-682 miR-682 Mus musculus
CUGCAGUCACAGUGAAGUCUG
611 picture button
mmu-miR-683 miR-683 Mus musculus
CCUGCUGUAAGCUGUGUCCUC
500 picture button
mmu-miR-684 miR-684 Mus musculus
AGUUUUCCCUUCAAGUCAA
503 picture button
mmu-miR-685 miR-685 Mus musculus
UCAAUGGCUGAGGUGAGGCAC
641 picture button
mmu-miR-686 miR-686 Mus musculus
AUUGCUUCCCAGACGGUGAAGA
529 picture button
mmu-miR-687 miR-687 Mus musculus
CUAUCCUGGAAUGCAGCAAUGA
586 picture button
mmu-miR-688 miR-688 Mus musculus
UCGCAGGCGACUACUUAUUC
533 picture button
mmu-miR-689 miR-689 Mus musculus
CGUCCCCGCUCGGCGGGGUCC
606 picture button
mmu-miR-690 miR-690 Mus musculus
AAAGGCUAGGCUCACAACCAAA
500 picture button
mmu-miR-691 miR-691 Mus musculus
AUUCCUGAAGAGAGGCAGAAAA
599 picture button
mmu-miR-692 miR-692 Mus musculus
AUCUCUUUGAGCGCCUCACUC
419 picture button
mmu-miR-693-5p miR-693 Mus musculus
CAGCCACAUCCGAAAGUUUUC
789 picture button
mmu-miR-693-3p miR-693 Mus musculus
GCAGCUUUCAGAUGUGGCUGUAA
614 picture button
mmu-miR-694 miR-694 Mus musculus
CUGAAAAUGUUGCCUGAAG
378 picture button
mmu-miR-695 miR-695 Mus musculus
AGAUUGGGCAUAGGUGACUGAA
536 picture button
mmu-miR-696 miR-696 Mus musculus
GCGUGUGCUUGCUGUGGG
603 picture button
mmu-miR-697 miR-697 Mus musculus
AACAUCCUGGUCCUGUGGAGA
616 picture button
mmu-miR-698 miR-698 Mus musculus
CAUUCUCGUUUCCUUCCCU
565 picture button
mmu-miR-699 miR-699 Mus musculus
AGGCAGUGCGACCUGGCUCG
498 picture button
mmu-miR-700 miR-700 Mus musculus
CACGCGGGAACCGAGUCCACC
627 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
523 picture button
mmu-miR-702 miR-702 Mus musculus
UGCCCACCCUUUACCCCGCUC
646 picture button
mmu-miR-703 miR-703 Mus musculus
AAAACCUUCAGAAGGAAAGAA
649 picture button
mmu-miR-704 miR-704 Mus musculus
AGACAUGUGCUCUGCUCCUAG
567 picture button
mmu-miR-705 miR-705 Mus musculus
GGUGGGAGGUGGGGUGGGCA
582 picture button
mmu-miR-706 miR-706 Mus musculus
AGAGAAACCCUGUCUCAAAAAA
569 picture button
mmu-miR-707 miR-707 Mus musculus
CAGUCAUGCCGCUUGCCUACG
571 picture button
hsa-miR-708 miR-708 Homo sapiens
AAGGAGCUUACAAUCUAGCUGGG
485 picture button
mmu-miR-709 miR-709 Mus musculus
GGAGGCAGAGGCAGGAGGA
567 picture button
mmu-miR-710 miR-710 Mus musculus
CCAAGUCUUGGGGAGAGUUGAG
602 picture button
mmu-miR-711 miR-711 Mus musculus
GGGACCCGGGGAGAGAUGUAAG
539 picture button
mmu-miR-712 miR-712 Mus musculus
CUCCUUCACCCGGGCGGUACC
539 picture button
mmu-miR-713 miR-713 Mus musculus
UGCACUGAAGGCACACAGC
599 picture button
mmu-miR-714 miR-714 Mus musculus
CGACGAGGGCCGGUCGGUCGC
625 picture button
mmu-miR-715 miR-715 Mus musculus
CUCCGUGCACACCCCCGCGUG
637 picture button
mmu-miR-717 miR-717 Mus musculus
CUCAGACAGAGAUACCUUCUCU
616 picture button
mmu-miR-718 miR-718 Mus musculus
CUUCCGCCCGGCCGGGUGUCG
525 picture button
mmu-miR-719 miR-719 Mus musculus
AUCUCGGCUACAGAAAAAUGUU
508 picture button
mmu-miR-720 miR-720 Mus musculus
AUCUCGCUGGGGCCUCCA
533 picture button
mmu-miR-721 miR-721 Mus musculus
CAGUGCAAUUAAAAGGGGGAA
632 picture button
mmu-miR-741 miR-741 Mus musculus
UGAGAGAUGCCAUUCUAUGUAGA
477 picture button
mmu-miR-742 miR-742 Mus musculus
GAAAGCCACCAUGCUGGGUAAA
646 picture button
mmu-miR-743b-3p miR-743 Mus musculus
GAAAGACAUCAUGCUGAAUAGA
589 picture button
mmu-miR-743a miR-743 Mus musculus
GAAAGACACCAAGCUGAGUAGA
609 picture button
mmu-miR-743b-5p miR-743 Mus musculus
UGUUCAGACUGGUGUCCAUCA
659 picture button
hsa-miR-744 miR-744 Homo sapiens
UGCGGGGCUAGGGCUAACAGCA
571 picture button
gga-miR-757 miR-757 Gallus gallus
GCAGAGCUGCAGAUGGGAUUC
537 picture button
hsa-miR-758 miR-758 Homo sapiens
UUUGUGACCUGGUCCACUAACC
584 picture button
mmu-miR-759 miR-759 Mus musculus
GCAGAGUGCAAACAAUUUUGAC
567 picture button
hsa-miR-760 miR-760 Homo sapiens
CGGCUCUGGGUCUGUGGGGA
459 picture button
mmu-miR-761 miR-761 Mus musculus
GCAGCAGGGUGAAACUGACACA
500 picture button
mmu-miR-762 miR-762 Mus musculus
GGGGCUGGGGCCGGGACAGAGC
558 picture button
mmu-miR-763 miR-763 Mus musculus
CCAGCUGGGAAGAACCAGUGGC
578 picture button
mmu-miR-764-5p miR-764 Mus musculus
GGUGCUCACAUGUCCUCCU
671 picture button
mmu-miR-764-3p miR-764 Mus musculus
AGGAGGCCAUAGUGGCAACUGU
684 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
411 picture button
hsa-miR-766 miR-766 Homo sapiens
ACUCCAGCCCCACAGCCUCAGC
624 picture button
hsa-miR-767-3p miR-767 Homo sapiens
UCUGCUCAUACCCCAUGGUUUCU
678 picture button
hsa-miR-767-5p miR-767 Homo sapiens
UGCACCAUGGUUGUCUGAGCAUG
706 picture button
hsa-miR-768-3p miR-768 Homo sapiens
UCACAAUGCUGACACUCAAACUGCUGAC
646 picture button
hsa-miR-768-5p miR-768 Homo sapiens
GUUGGAGGAUGAAAGUACGGAGUGAU
586 picture button
hsa-miR-769-5p miR-769 Homo sapiens
UGAGACCUCUGGGUUCUGAGCU
685 picture button
hsa-miR-769-3p miR-769 Homo sapiens
CUGGGAUCUCCGGGGUCUUGGUU
694 picture button
hsa-miR-770-5p miR-770 Homo sapiens
UCCAGUACCACGUGUCAGGGCCA
601 picture button
hsa-miR-801 miR-801 Homo sapiens
GAUUGCUCUGCGUGCGGAAUCGAC
541 picture button

Page 6 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer