spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
hsa-miR-338-5p miR-338 Homo sapiens
AACAAUAUCCUGGUGCUGAGUG
695 picture button
hsa-miR-338-3p miR-338 Homo sapiens
UCCAGCAUCAGUGAUUUUGUUG
647 picture button
hsa-miR-339-3p miR-339 Homo sapiens
UGAGCGCCUCGACGACAGAGCCG
656 picture button
hsa-miR-339-5p miR-339 Homo sapiens
UCCCUGUCCUCCAGGAGCUCACG
673 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
467 picture button
mmu-miR-341 miR-341 Mus musculus
UCGGUCGAUCGGUCGGUCGGU
600 picture button
bta-miR-342 miR-342 Bos taurus
UCUCACACAGAAAUCGCACCCAUCU
609 picture button
mmu-miR-343 miR-343 Mus musculus
UCUCCCUUCAUGUGCCCAGA
461 picture button
mmu-miR-344 miR-344 Mus musculus
UGAUCUAGCCAAAGCCUGACUGU
527 picture button
bta-miR-345 miR-345 Bos taurus
GCUGACUCCUAGUCCAGUGCU
588 picture button
hsa-miR-346 miR-346 Homo sapiens
UGUCUGCCCGCAUGCCUGCCUCU
549 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
522 picture button
rno-miR-349 miR-349 Rattus norvegicus
CAGCCCUGCUGUCUUAACCUCU
614 picture button
mmu-miR-350 miR-350 Mus musculus
UUCACAAAGCCCAUACACUUUC
680 picture button
mmu-miR-351 miR-351 Mus musculus
UCCCUGAGGAGCCCUUUGAGCCUG
629 picture button
rno-miR-352 miR-352 Rattus norvegicus
AGAGUAGUAGGUUGCAUAGUA
502 picture button
bta-miR-361 miR-361 Bos taurus
UUAUCAGAAUCUCCAGGGGUAC
605 picture button
hsa-miR-362-3p miR-362 Homo sapiens
AACACACCUAUUCAAGGAUUCA
689 picture button
hsa-miR-362-5p miR-362 Homo sapiens
AAUCCUUGGAACCUAGGUGUGAGU
661 picture button
bta-miR-363 miR-363 Bos taurus
AUUGCACGGUAUCCAUCUGCG
617 picture button
gga-miR-365 miR-365 Gallus gallus
UAAUGCCCCUAAAAAUCCUUAU
669 picture button
gga-miR-367 miR-367 Gallus gallus
AAUUGCACUUUAGCAAUGGUG
695 picture button
bta-miR-369-5p miR-369 Bos taurus
AUCGACCGUGUUAUAUUCGC
674 picture button
bta-miR-369-3p miR-369 Bos taurus
AAUAAUACAUGGUUGAUCUUU
680 picture button
hsa-miR-370 miR-370 Homo sapiens
GCCUGCUGGGGUGGAACCUGGU
526 picture button
hsa-miR-371-3p miR-371 Homo sapiens
AAGUGCCGCCAUCUUUUGAGUGU
672 picture button
hsa-miR-371-5p miR-371 Homo sapiens
ACUCAAACUGUGGGGGCACU
701 picture button
hsa-miR-372 miR-372 Homo sapiens
AAAGUGCUGCGACAUUUGAGCGU
577 picture button
hsa-miR-373 miR-373 Homo sapiens
GAAGUGCUUCGAUUUUGGGGUGU
571 picture button
bta-miR-374 miR-374 Bos taurus
UUAUAAUACAACCUGAUAAGUG
465 picture button
gga-miR-375 miR-375 Gallus gallus
UUUGUUCGUUCGGCUCGCGUUA
632 picture button
hsa-miR-376a miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCACGU
628 picture button
hsa-miR-376c miR-376 Homo sapiens
AACAUAGAGGAAAUUCCACGU
613 picture button
hsa-miR-376b miR-376 Homo sapiens
AUCAUAGAGGAAAAUCCAUGUU
590 picture button
hsa-miR-377 miR-377 Homo sapiens
AUCACACAAAGGCAACUUUUGU
594 picture button
hsa-miR-378 miR-378 Homo sapiens
ACUGGACUUGGAGUCAGAAGG
599 picture button
hsa-miR-379 miR-379 Homo sapiens
UGGUAGACUAUGGAACGUAGG
554 picture button
bta-miR-380-5p miR-380 Bos taurus
UGGUUGACCAUAGAACAUGCGC
621 picture button
bta-miR-380-3p miR-380 Bos taurus
UAUGUAAUGUGGUCCACGUCU
545 picture button
hsa-miR-381 miR-381 Homo sapiens
UAUACAAGGGCAAGCUCUCUGU
506 picture button
hsa-miR-382 miR-382 Homo sapiens
GAAGUUGUUCGUGGUGGAUUCG
530 picture button
gga-miR-383 miR-383 Gallus gallus
AGAUCAGAAGGUGAUUGUGGCU
665 picture button
hsa-miR-384 miR-384 Homo sapiens
AUUCCUAGAAAUUGUUCAUA
546 picture button
hsa-miR-409-5p miR-409 Homo sapiens
AGGUUACCCGAGCAACUUUGCAU
651 picture button
hsa-miR-409-3p miR-409 Homo sapiens
GAAUGUUGCUCGGUGAACCCCU
664 picture button
hsa-miR-410 miR-410 Homo sapiens
AAUAUAACACAGAUGGCCUGU
526 picture button
hsa-miR-411 miR-411 Homo sapiens
UAGUAGACCGUAUAGCGUACG
623 picture button
hsa-miR-412 miR-412 Homo sapiens
ACUUCACCUGGUCCACUAGCCGU
588 picture button
hsa-miR-421 miR-421 Homo sapiens
AUCAACAGACAUUAAUUGGGCGC
623 picture button
hsa-miR-422a miR-422 Homo sapiens
ACUGGACUUAGGGUCAGAAGGC
625 picture button
bta-miR-423 miR-423 Bos taurus
AAGCUCGGUCUGAGGCCCCUCAGU
529 picture button
hsa-miR-424 miR-424 Homo sapiens
CAGCAGCAAUUCAUGUUUUGAA
488 picture button
bta-miR-425-3p miR-425 Bos taurus
AUCGGGAAUGUCGUGUCCGCCC
634 picture button
bta-miR-425-5p miR-425 Bos taurus
AUGACACGAUCACUCCCGUUGA
680 picture button
gga-miR-429 miR-429 Gallus gallus
UAAUACUGUCUGGUAAUGCCGU
671 picture button
hsa-miR-431 miR-431 Homo sapiens
UGUCUUGCAGGCCGUCAUGCA
584 picture button
hsa-miR-432 miR-432 Homo sapiens
UCUUGGAGUAGGUCAUUGGGUGG
538 picture button
hsa-miR-433 miR-433 Homo sapiens
AUCAUGAUGGGCUCCUCGGUGU
612 picture button
mmu-miR-434-5p miR-434 Mus musculus
GCUCGACUCAUGGUUUGAACCA
641 picture button
mmu-miR-434-3p miR-434 Mus musculus
UUUGAACCAUCACUCGACUCCU
702 picture button
cfa-miR-448 miR-448 Canis familiaris
UUGCAUAUGUAGGAUGUCCCAU
546 picture button
gga-miR-449 miR-449 Gallus gallus
UGGCAGUGUAUGUUAGCUGGU
574 picture button
bta-miR-450 miR-450 Bos taurus
UUUUGCGAUGUGUUCCUAAUAU
582 picture button
gga-miR-451 miR-451 Gallus gallus
AAACCGUUACCAUUACUGAGUUU
676 picture button
hsa-miR-452 miR-452 Homo sapiens
AACUGUUUGCAGAGGAAACUGA
583 picture button
hsa-miR-453 miR-453 Homo sapiens
AGGUUGUCCGUGGUGAGUUCGCA
592 picture button
hsa-miR-454 miR-454 Homo sapiens
UAGUGCAAUAUUGCUUAUAGGGU
668 picture button
gga-miR-455 miR-455 Gallus gallus
UAUGUGCCCUUGGACUACAUCG
655 picture button
gga-miR-456 miR-456 Gallus gallus
CAGGCUGGUUAGAUGGUUGUCA
561 picture button
gga-miR-460 miR-460 Gallus gallus
CCUGCAUUGUACACACUGUGUG
579 picture button
mmu-miR-463 miR-463 Mus musculus
UGAUAGACACCAUAUAAGGUAG
525 picture button
mmu-miR-464 miR-464 Mus musculus
UACCAAGUUUAUUCUGUGAGAUA
585 picture button
mmu-miR-465a-5p miR-465 Mus musculus
UAUUUAGAAUGGCACUGAUGUGA
539 picture button
mmu-miR-465c-5p miR-465 Mus musculus
UAUUUAGAAUGGCGCUGAUCUG
591 picture button
mmu-miR-465a-3p miR-465 Mus musculus
GAUCAGGGCCUUUCUAAGUAGA
569 picture button
mmu-miR-465b-5p miR-465 Mus musculus
UAUUUAGAAUGGUGCUGAUCUG
562 picture button
gga-miR-466 miR-466 Gallus gallus
AUAUAUACACACACACAUAAGAC
862 picture button
mmu-miR-467c miR-467 Mus musculus
UAAGUGCGUGCAUGUAUAUGUG
758 picture button
mmu-miR-467e miR-467 Mus musculus
AUAAGUGUGAGCAUGUAUAUGU
717 picture button
mmu-miR-467b miR-467 Mus musculus
GUAAGUGCCUGCAUGUAUAUG
817 picture button
mmu-miR-467d miR-467 Mus musculus
UAAGUGCGCGCAUGUAUAUGCG
721 picture button
mmu-miR-467a miR-467 Mus musculus
UAAGUGCCUGCAUGUAUAUGCG
793 picture button
mmu-miR-468 miR-468 Mus musculus
UAUGACUGAUGUGCGUGUGUCUG
601 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
509 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
595 picture button
mmu-miR-471 miR-471 Mus musculus
UACGUAGUAUAGUGCUUUUCAC
598 picture button
hsa-miR-483-5p miR-483 Homo sapiens
AAGACGGGAGGAAAGAAGGGAG
578 picture button
hsa-miR-483-3p miR-483 Homo sapiens
UCACUCCUCUCCUCCCGUCUU
658 picture button
bta-miR-484 miR-484 Bos taurus
UCAGGCUCAGUCCCCUCCCGAU
623 picture button
hsa-miR-485-3p miR-485 Homo sapiens
GUCAUACACGGCUCUCCUCUCU
636 picture button
hsa-miR-485-5p miR-485 Homo sapiens
AGAGGCUGGCCGUGAUGAAUUC
585 picture button
hsa-miR-486-5p miR-486 Homo sapiens
UCCUGUACUGAGCUGCCCCGAG
697 picture button
hsa-miR-486-3p miR-486 Homo sapiens
CGGGGCAGCUCAGUACAGGAU
529 picture button
bta-miR-487b miR-487 Bos taurus
AAUCGUACAGGGUCAUCCACUU
622 picture button
bta-miR-487a miR-487 Bos taurus
AAUCAUACAGGGACAUCCAGU
603 picture button
hsa-miR-488 miR-488 Homo sapiens
UUGAAAGGCUAUUUCUUGGUC
472 picture button
gga-miR-489 miR-489 Gallus gallus
AGUGACAUCAUAUGUACGGCUGC
619 picture button
gga-miR-490 miR-490 Gallus gallus
CAACCUGGAGGACUCCAUGCUG
624 picture button
hsa-miR-491-5p miR-491 Homo sapiens
AGUGGGGAACCCUUCCAUGAGG
555 picture button
hsa-miR-491-3p miR-491 Homo sapiens
CUUAUGCAAGAUUCCCUUCUAC
600 picture button

Page 3 of 7
<< prev 1 2 3 4 5 6 7 next >>

spacer
spacer