spacer

MicroRNA Listing for Gallus gallus


651 microRNAs (131 native)


Page 1 of 7
1 2 3 4 5 6 7 next >>

miRNA ID Family Source Species Sequence No. Targets
picture button picture button picture button picture button picture button
bta-miR-450 miR-450 Bos taurus
UUUUGCGAUGUGUUCCUAAUAU
582 picture button
hsa-miR-507 miR-507 Homo sapiens
UUUUGCACCUUUUGGAGUGAA
643 picture button
gga-miR-375 miR-375 Gallus gallus
UUUGUUCGUUCGGCUCGCGUUA
632 picture button
hsa-miR-758 miR-758 Homo sapiens
UUUGUGACCUGGUCCACUAACC
584 picture button
hsa-miR-96 miR-96 Homo sapiens
UUUGGCACUAGCACAUUUUUGCU
652 picture button
hsa-miR-182 miR-182 Homo sapiens
UUUGGCAAUGGUAGAACUCACACU
678 picture button
mmu-miR-434-3p miR-434 Mus musculus
UUUGAACCAUCACUCGACUCCU
702 picture button
gga-miR-202* miR-202* Gallus gallus
UUUCCUAUGCAUAUACUUCUUU
466 picture button
hsa-miR-587 miR-587 Homo sapiens
UUUCCAUAGGUGAUGAGUCAC
611 picture button
hsa-miR-498 miR-498 Homo sapiens
UUUCAAGCCAGGGGGCGUUUUUC
635 picture button
hsa-miR-651 miR-651 Homo sapiens
UUUAGGAUAAGCUUGACUUUUG
483 picture button
gga-miR-302c* miR-302* Gallus gallus
UUUAACAUGGAGGUACCUGCUG
568 picture button
hsa-miR-592 miR-592 Homo sapiens
UUGUGUCAAUAUGCGAUGAUGU
553 picture button
gga-miR-218 miR-218 Gallus gallus
UUGUGCUUGAUCUAACCAUGU
564 picture button
gga-miR-133a miR-133 Gallus gallus
UUGGUCCCCUUCAACCAGCUGU
644 picture button
gga-miR-133c miR-133 Gallus gallus
UUGGUCCCCUUCAACCAGCUGC
622 picture button
gga-miR-133b miR-133 Gallus gallus
UUGGUCCCCUUCAACCAGCUA
625 picture button
hsa-miR-588 miR-588 Homo sapiens
UUGGCCACAAUGGGUUAGAAC
614 picture button
cfa-miR-448 miR-448 Canis familiaris
UUGCAUAUGUAGGAUGUCCCAU
546 picture button
gga-miR-153 miR-153 Gallus gallus
UUGCAUAGUCACAAAAGUGA
660 picture button
hsa-miR-580 miR-580 Homo sapiens
UUGAGAAUGAUGAAUCAUUAGG
445 picture button
hsa-miR-488 miR-488 Homo sapiens
UUGAAAGGCUAUUUCUUGGUC
472 picture button
mmu-miR-470 miR-470 Mus musculus
UUCUUGGACUGGCACUGGUGAGU
595 picture button
hsa-miR-516a-5p miR-516 Homo sapiens
UUCUCGAGGAAAGAAGCACUUUC
709 picture button
hsa-miR-515-5p miR-515 Homo sapiens
UUCUCCAAAAGAAAGCACUUUCUG
737 picture button
hsa-miR-211 miR-211 Homo sapiens
UUCCCUUUGUCAUCCUUCGCCU
460 picture button
gga-miR-204 miR-204 Gallus gallus
UUCCCUUUGUCAUCCUAUGCCU
490 picture button
hsa-miR-579 miR-579 Homo sapiens
UUCAUUUGGUAUAAACCGCGAUU
503 picture button
mmu-miR-677 miR-677 Mus musculus
UUCAGUGAUGAUUAGCUUCUGA
583 picture button
hsa-miR-197 miR-197 Homo sapiens
UUCACCACCUUCUCCACCCAGC
611 picture button
gga-miR-27b miR-27 Gallus gallus
UUCACAGUGGCUAAGUUCUGC
649 picture button
hsa-miR-513-5p miR-513 Homo sapiens
UUCACAGGGAGGUGUCAU
654 picture button
mmu-miR-350 miR-350 Mus musculus
UUCACAAAGCCCAUACACUUUC
680 picture button
gga-miR-26a miR-26 Gallus gallus
UUCAAGUAAUCCAGGAUAGGC
638 picture button
hsa-miR-95 miR-95 Homo sapiens
UUCAACGGGUAUUUAUUGAGCA
585 picture button
hsa-miR-584 miR-584 Homo sapiens
UUAUGGUUUGCCUGGGACUGAG
520 picture button
bta-miR-361 miR-361 Bos taurus
UUAUCAGAAUCUCCAGGGGUAC
605 picture button
bta-miR-374 miR-374 Bos taurus
UUAUAAUACAACCUGAUAAGUG
465 picture button
hsa-miR-340 miR-340 Homo sapiens
UUAUAAAGCAAUGAGACUGAUU
467 picture button
mmu-miR-701 miR-701 Mus musculus
UUAGCCGCUGAAAUAGAUGGA
523 picture button
hsa-miR-582-5p miR-582 Homo sapiens
UUACAGUUGUUCAACCAGUUACU
616 picture button
gga-miR-155 miR-155 Gallus gallus
UUAAUGCUAAUCGUGAUAGGGG
617 picture button
hsa-miR-889 miR-889 Homo sapiens
UUAAUAUCGGACAACCAUUGU
547 picture button
gga-miR-124a miR-124 Gallus gallus
UUAAGGCACGCGGUGAAUGCCA
616 picture button
gga-miR-124b miR-124 Gallus gallus
UUAAGGCACGCAGUGAAUGCCA
591 picture button
gga-miR-499 miR-499 Gallus gallus
UUAAGACUUGUAGUGAUGUUUAG
549 picture button
mmu-miR-743b-5p miR-743 Mus musculus
UGUUCAGACUGGUGUCCAUCA
659 picture button
hsa-miR-597 miR-597 Homo sapiens
UGUGUCACUCGAUGACCACUGU
571 picture button
hsa-miR-636 miR-636 Homo sapiens
UGUGCUUGCUCGUCCCGCCCGCA
489 picture button
hsa-miR-933 miR-933 Homo sapiens
UGUGCGCAGGGAGACCUCUCCC
523 picture button
gga-miR-19a miR-19 Gallus gallus
UGUGCAAAUCUAUGCAAAACUGA
677 picture button
gga-miR-19b miR-19 Gallus gallus
UGUGCAAAUCCAUGCAAAACUGA
662 picture button
mmu-miR-804 miR-804 Mus musculus
UGUGAGUUGUUCCUCACCUGGA
526 picture button
hsa-miR-134 miR-134 Homo sapiens
UGUGACUGGUUGACCAGAGGGG
622 picture button
hsa-miR-542-3p miR-542 Homo sapiens
UGUGACAGAUUGAUAACUGAAA
648 picture button
hsa-miR-431 miR-431 Homo sapiens
UGUCUUGCAGGCCGUCAUGCA
584 picture button
hsa-miR-346 miR-346 Homo sapiens
UGUCUGCCCGCAUGCCUGCCUCU
549 picture button
hsa-miR-593 miR-593 Homo sapiens
UGUCUCUGCUGGGGUUUCU
506 picture button
hsa-miR-934 miR-934 Homo sapiens
UGUCUACUACUGGAGACACUGG
548 picture button
rno-miR-347 miR-347 Rattus norvegicus
UGUCCCUCUGGGUCGCCCA
522 picture button
gga-miR-223 miR-223 Gallus gallus
UGUCAGUUUGUCAAAUACCCC
614 picture button
hsa-miR-668 miR-668 Homo sapiens
UGUCACUCGGCUCGGCCCACUAC
533 picture button
gga-miR-142-3p miR-142 Gallus gallus
UGUAGUGUUUCCUACUUUAUGG
686 picture button
gga-miR-194 miR-194 Gallus gallus
UGUAACAGCAACUCCAUGUGGA
614 picture button
gga-miR-30e miR-30 Gallus gallus
UGUAAACAUCCUUGACUGG
744 picture button
gga-miR-30a-5p miR-30 Gallus gallus
UGUAAACAUCCUCGACUGGAAG
722 picture button
gga-miR-30c miR-30 Gallus gallus
UGUAAACAUCCUACACUCUCAGCU
727 picture button
gga-miR-30b miR-30 Gallus gallus
UGUAAACAUCCUACACUCAGCU
744 picture button
gga-miR-30d miR-30 Gallus gallus
UGUAAACAUCCCCGACUGGAAG
712 picture button
hsa-miR-299-5p miR-299 Homo sapiens
UGGUUUACCGUCCCACAUACAU
634 picture button
bta-miR-380-5p miR-380 Bos taurus
UGGUUGACCAUAGAACAUGCGC
621 picture button
hsa-miR-876-3p miR-876 Homo sapiens
UGGUGGUUUACAAAGUAAUUCA
586 picture button
hsa-miR-654-5p miR-654 Homo sapiens
UGGUGGGCCGCAGAACAUGUGC
653 picture button
hsa-miR-541 miR-541 Homo sapiens
UGGUGGGCACAGAAUCUGGACU
579 picture button
hsa-miR-675 miR-675 Homo sapiens
UGGUGCGGAGAGGGCCCACAGUG
559 picture button
hsa-miR-601 miR-601 Homo sapiens
UGGUCUAGGAUUGUUGGAGGAG
551 picture button
hsa-miR-379 miR-379 Homo sapiens
UGGUAGACUAUGGAACGUAGG
554 picture button
hsa-miR-629 miR-629 Homo sapiens
UGGGUUUACGUUGGGAGAACU
536 picture button
hsa-miR-939 miR-939 Homo sapiens
UGGGGAGCUGAGGCUCUGGGGGUG
518 picture button
hsa-miR-585 miR-585 Homo sapiens
UGGGCGUAUCUGUAUGCUA
583 picture button
gga-miR-24 miR-24 Gallus gallus
UGGCUCAGUUCAGCAGGAACAG
598 picture button
gga-miR-34a miR-34 Gallus gallus
UGGCAGUGUCUUAGCUGGUUGUU
674 picture button
gga-miR-449 miR-449 Gallus gallus
UGGCAGUGUAUGUUAGCUGGU
574 picture button
hsa-miR-876-5p miR-876 Homo sapiens
UGGAUUUCUUUGUGAAUCACCA
621 picture button
gga-miR-122 miR-122 Gallus gallus
UGGAGUGUGACAAUGGUGUUUGU
592 picture button
hsa-miR-765 miR-765 Homo sapiens
UGGAGGAGAAGGAAGGUGAUG
411 picture button
hsa-miR-185 miR-185 Homo sapiens
UGGAGAGAAAGGCAGUUCCUGA
441 picture button
gga-miR-184 miR-184 Gallus gallus
UGGACGGAGAACUGAUAAGGGU
578 picture button
gga-miR-1b miR-1 Gallus gallus
UGGAAUGUUAAGAAGUAUGUA
561 picture button
gga-miR-206 miR-206 Gallus gallus
UGGAAUGUAAGGAAGUGUGUGG
559 picture button
gga-miR-1a miR-1 Gallus gallus
UGGAAUGUAAAGAAGUAUGUA
582 picture button
gga-miR-7b miR-7 Gallus gallus
UGGAAGACUAGUGAUUUUUGUU
605 picture button
gga-miR-7 miR-7 Gallus gallus
UGGAAGACUAGUGAUUUUGUUG
614 picture button
hsa-miR-516a-3p miR-516 Homo sapiens
UGCUUCCUUUCAGAGGGU
662 picture button
mmu-miR-883a-5p miR-883 Mus musculus
UGCUGAGAGAAGUAGCAGUUAC
737 picture button
hsa-miR-744 miR-744 Homo sapiens
UGCGGGGCUAGGGCUAACAGCA
571 picture button
hsa-miR-661 miR-661 Homo sapiens
UGCCUGGGUCUCUGGCCUGCGCGU
509 picture button
mmu-miR-469 miR-469 Mus musculus
UGCCUCUUUCAUUGAUCUUGGUGUCC
509 picture button
hsa-miR-938 miR-938 Homo sapiens
UGCCCUUAAAGGUGAACCCAGU
585 picture button
mmu-miR-702 miR-702 Mus musculus
UGCCCACCCUUUACCCCGCUC
646 picture button

Page 1 of 7
1 2 3 4 5 6 7 next >>

spacer
spacer