spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Anopheles gambiae
dme-bantam bantam Drosophila melanogaster
UGAGAUCAUUUUGAAAGCUGAUU
Drosophila melanogaster
dps-bantam bantam Drosophila pseudoobscura
UGAGAUCAUUUUGAAAGCUGAUU
Drosophila pseudoobscura
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Aedes aegypti
 
cel-lin-4 lin-4 Caenorhabditis elegans
UCCCUGAGACCUCAAGUGUGA
Caenorhabditis elegans
cbr-lin-4 lin-4 Caenorhabditis briggsae
UCCCUGAGACCUCAAGUGUGA
Caenorhabditis briggsae
 
cbr-lsy-6 lsy-6 Caenorhabditis briggsae
UUUUGUAUGAGACGCAUUCCG
Caenorhabditis briggsae
cel-lsy-6 lsy-6 Caenorhabditis elegans
UUUUGUAUGAGACGCAUUUCG
Caenorhabditis elegans
 
dre-let-7d let-7 Danio rerio
UGAGGUAGUUGGUUGUAUGGUU
Danio rerio
 
rno-let-7b* let-7* Rattus norvegicus
CUAUACAACCUACUGCCUUCCC
Rattus norvegicus
hsa-let-7b* let-7* Homo sapiens
CUAUACAACCUACUGCCUUCCC
Homo sapiens
 
mmu-let-7g let-7 Mus musculus
UGAGGUAGUAGUUUGUACAGUU
Mus musculus
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
Takifugu rubripes
dme-let-7 let-7 Drosophila melanogaster
UGAGGUAGUAGGUUGUAUAGU
Drosophila melanogaster
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
Pan troglodytes
cbr-let-7 let-7 Caenorhabditis briggsae
UGAGGUAGUAGGUUGUAUAGUU
Caenorhabditis briggsae
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
Oryzias latipes
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Canis familiaris
mdo-let-7i let-7 Monodelphis domestica
UGAGGUAGUAGUUUGUGCUGU
Monodelphis domestica
rno-let-7a let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUAGUU
Rattus norvegicus
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
Homo sapiens
gga-let-7f let-7 Gallus gallus
UGAGGUAGUAGAUUGUAUAGUU
Gallus gallus
bta-let-7i let-7 Bos taurus
UGAGGUAGUAGUUUGUGCUGUU
Ornithorhynchus anatinus
tni-let-7i let-7 Tetraodon nigroviridis
UGAGGUAGUAGUUUGUGCUGUU
Tetraodon nigroviridis
fru-let-7e let-7 Takifugu rubripes
UGAGGUAGUAGAUUGAAUAGUU
Gasterosteus aculeatus
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Bos taurus
xtr-let-7b let-7 Xenopus tropicalis
UGAGGUAGUAGUUUGUGUAGUU
Xenopus tropicalis
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
Macaca mulatta
dre-let-7f let-7 Danio rerio
UGAGGUAGUAGAUUGUAUAGUU
Danio rerio
 
rno-let-7e* let-7* Rattus norvegicus
CUAUACGGCCUCCUAGCUUUCC
Rattus norvegicus
hsa-let-7d* let-7* Homo sapiens
CUAUACGACCUGCUGCCUUUCU
Homo sapiens
mmu-let-7a* let-7* Mus musculus
CUAUACAAUCUACUGUCUUUCC
Mus musculus
 
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Ornithorhynchus anatinus
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
Takifugu rubripes
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
Pan troglodytes
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
Oryzias latipes
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Canis familiaris
rno-let-7c let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUAUGGUU
Rattus norvegicus
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
Homo sapiens
mmu-let-7b let-7 Mus musculus
UGAGGUAGUAGGUUGUGUGGUU
Mus musculus
fru-let-7a let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUAUAGUU
Takifugu rubripes
gga-let-7i let-7 Gallus gallus
UGAGGUAGUAGUUUGUGCUGU
Gallus gallus
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
Gasterosteus aculeatus
fru-let-7a let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUAUAGUU
Oryzias latipes
mdo-let-7a let-7 Monodelphis domestica
UGAGGUAGUAGGUUGUAUAGUU
Monodelphis domestica
xtr-let-7e let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUUUAGUU
Xenopus tropicalis
hsa-let-7d let-7 Homo sapiens
AGAGGUAGUAGGUUGCAUAGUU
Macaca mulatta
dre-let-7h let-7 Danio rerio
UGAGGUAGUAAGUUGUGUUGUU
Danio rerio
 
hsa-let-7f-1* let-7* Homo sapiens
CUAUACAAUCUAUUGCCUUCCC
Homo sapiens
mmu-let-7c-1* let-7* Mus musculus
CUGUACAACCUUCUAGCUUUCC
Mus musculus
 
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Ornithorhynchus anatinus
tni-let-7b let-7 Tetraodon nigroviridis
UGAGGUAGUAGGUUGUGUGGUU
Tetraodon nigroviridis
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
Pan troglodytes
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
Bos taurus
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
Canis familiaris
dre-let-7a let-7 Danio rerio
UGAGGUAGUAGGUUGUAUAGUU
Danio rerio
rno-let-7e let-7 Rattus norvegicus
UGAGGUAGGAGGUUGUAUAGUU
Rattus norvegicus
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
Homo sapiens
mmu-let-7d let-7 Mus musculus
AGAGGUAGUAGGUUGCAUAGUU
Mus musculus
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
Takifugu rubripes
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
Gasterosteus aculeatus
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
Oryzias latipes
mdo-let-7d let-7 Monodelphis domestica
AGAGGUAGUAGGUUGCAUAGU
Monodelphis domestica
xtr-let-7g let-7 Xenopus tropicalis
UGAGGUAGUUGUUUGUACAGU
Xenopus tropicalis
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
Macaca mulatta
dre-let-7j let-7 Danio rerio
UGAGGUAGUUGUUUGUACAGUU
Danio rerio
 
hsa-let-7g* let-7* Homo sapiens
CUGUACAGGCCACUGCCUUGC
Homo sapiens
mmu-let-7f* let-7* Mus musculus
CUAUACAAUCUAUUGCCUUCCC
Mus musculus
 
gga-let-7b let-7 Gallus gallus
UGAGGUAGUAGGUUGUGUGGUU
Gallus gallus
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
Ornithorhynchus anatinus
tni-let-7e let-7 Tetraodon nigroviridis
UGAGGUAGUAGAUUGAAUAGUU
Tetraodon nigroviridis
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
Pan troglodytes
fru-let-7a let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUAUAGUU
Gasterosteus aculeatus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Bos taurus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Canis familiaris
dre-let-7c let-7 Danio rerio
UGAGGUAGUAGGUUGUAUGGUU
Danio rerio
rno-let-7i let-7 Rattus norvegicus
UGAGGUAGUAGUUUGUGCUGUU
Rattus norvegicus
 
hsa-let-7a* let-7* Homo sapiens
CUAUACAAUCUACUGUCUUUC
Homo sapiens
 
mmu-let-7f let-7 Mus musculus
UGAGGUAGUAGAUUGUAUAGUU
Mus musculus
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
Takifugu rubripes
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
Pan troglodytes
dps-let-7 let-7 Drosophila pseudoobscura
UGAGGUAGUAGGUUGUAUAGU
Drosophila pseudoobscura
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
Oryzias latipes
mdo-let-7g let-7 Monodelphis domestica
UGAGGUAGUAGUUUGUACAGU
Monodelphis domestica
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
Homo sapiens
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
Macaca mulatta
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Aedes aegypti
 
mmu-let-7i* let-7* Mus musculus
CUGCGCAAGCUACUGCCUUGCU
Mus musculus
 
gga-let-7d let-7 Gallus gallus
AGAGGUAGUGGGUUGCAUAGU
Gallus gallus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Ornithorhynchus anatinus
tni-let-7h let-7 Tetraodon nigroviridis
UGAGGUAGUAAGUUGUGUUGUU
Tetraodon nigroviridis
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
Gasterosteus aculeatus
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Bos taurus
 
bta-let-7a* let-7* Bos taurus
CUAUACAAUCUACUGUCUUUC
Bos taurus
 
xtr-let-7a let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUAUAGUU
Xenopus tropicalis
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
Macaca mulatta
dre-let-7e let-7 Danio rerio
UGAGGUAGUAGAUUGAAUAGUU
Danio rerio
 
rno-let-7d* let-7* Rattus norvegicus
CUAUACGACCUGCUGCCUUUCU
Rattus norvegicus
hsa-let-7c* let-7* Homo sapiens
UAGAGUUACACCCUGGGAGUUA
Homo sapiens
 
mmu-let-7i let-7 Mus musculus
UGAGGUAGUAGUUUGUGCUGUU
Mus musculus

Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

spacer
spacer