spacer

Target Detailed View


Hit information for ENSMMUT00000046249

Gene Name HAO2
Transcript ENSMMUT00000046249
Gene ENSMMUG00000016567
Description Hydroxyacid oxidase 2 (EC 1.1.3.15) (HAOX2) ((S)-2-hydroxy-acid oxidase, peroxisomal) (Long chain alpha-hydroxy acid oxidase) (Long- chain L-2-hydroxy acid oxidase). [Source:Uniprot/SWISSPROT;Acc:Q9NYQ3]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mml-miR-15a 19.6707 -19.03 3.512320e-03 1.709880e-03 1.391290e-04 207 228
GUGUUUGGUAAUACACGACGAu
||| :||::|||| ||:||||
CACTGACTGTTATATGTTGCTt
mmu-miR-804 17.9651 -23.34 6.735650e-03 6.713020e-03 1.147450e-03 37 59
agGUCCACUCCUUG-UUGAGUGU
  |||| |:   || ||||||||
caCAGGAGGATCACAAACTCACA
mml-miR-103 17.8748 -20.39 1.260460e-02 1.177290e-03 2.145180e-05 55 79
AGUAUCGGG--ACAUGUUACGACGa
||| ||| :  |||:::||||||:
TCACAGCATGGTGTGTGATGCTGTc
hsa-miR-939 17.7891 -30.42 4.003260e-02 3.924190e-02 2.776010e-02 158 182
guGGGGGUCUCGGAGU-CGAGGGGU
  ||:||| | || :: |:||||||
gcCCTCCAAACCCCTGTGTTCCCCA
hsa-miR-768-5p 17.6302 -27.55 1.841750e-02 1.824890e-02 1.435540e-03 140 167
uaGUGAGG-CAUGAA-AGUAGGAGGUUg
  ||| || ||:|||   : |||||||
tcCACCCCTGTGCTTCAGGCCCTCCAAa
hsa-miR-608 17.4836 -26.55 4.394740e-02 1.976120e-03 1.976120e-03 74 98
UGCCUCGACAGGGUUGUGGUGGGGa
:| |  ||| |: :|| |||:|||
GCTGTCCTGCCTGGACCCCATCCCg
hsa-miR-202 17.4722 -22.35 1.266860e-02 1.258870e-02 1.258870e-02 105 124
aaGGGUACGGGAUAUGGAGa
  |::|||||| |||::||
ggCTTATGCCCCATATTTCc
hsa-miR-524-5p 17.3966 -12.01 2.761140e-02 2.723370e-02 1.852760e-02 185 206
cucuuucACGAAGGGAAACAUc
       |||  ::|||||||
tgttccaTGCCCTTCTTTGTAt
mml-miR-15b 17.3966 -11.75 2.359810e-02 1.709880e-03 1.391290e-04 207 228
acauUUGGUACUACACGACGAu
    :||::| || ||:||||
cactGACTGTTATATGTTGCTt
hsa-miR-940 17.1462 -20.77 4.165270e-02 4.079710e-02 5.876090e-03 64 86
CCCCUCGC--CCCCGGGACGGAa
|| | |:|  |  |:|||||||
GGTGTGTGATGCTGTCCTGCCTg
hsa-miR-608 17.0353 -24.33 6.422350e-02 1.976120e-03 1.976120e-03 121 148
ugccucgacAGGGUU---GUGGUGGGGA
         |:||||   | ||||||||
ttcccatatTTCCAATCCCTCCACCCCT
hsa-miR-497 17.0319 -10.53 3.569530e-02 3.506570e-02 2.450930e-02 208 228
UGUUUGGUGUCACACGACGAc
|| :||:::  | ||:||||
ACTGACTGTTATATGTTGCTt
hsa-miR-520d-5p 17.0124 -9.93 3.484240e-02 3.424240e-02 1.198500e-03 187 206
cuuuccCGAAGGGAAACAUc
      ||  ::|||||||
ttccatGCCCTTCTTTGTAt
mml-miR-107 16.9697 -18.17 2.870310e-02 1.381800e-03 1.961170e-04 55 79
ACUAUCGGG--ACAUGUUACGACGa
| | ||| :  |||:::||||||:
TCACAGCATGGTGTGTGATGCTGTc
hsa-miR-338-3p 16.9418 -15.75 3.075490e-02 3.028680e-02 3.749190e-03 58 79
GUUGUUUUAGUGACUACGACcu
||:|| ::|   ||||||||
CAGCATGGTGTGTGATGCTGtc
mml-miR-16 16.9418 -12.19 3.375760e-02 3.319420e-02 1.673600e-03 207 228
GCGGUUAUAAAUGCACGACGAu
| |::|   |||: ||:||||
CACTGACTGTTATATGTTGCTt
mmu-miR-695 16.9418 -13.86 1.747400e-02 1.732220e-02 1.301170e-03 117 138
aagucAGUGGAUACGGGUUAGa
     || | ||| :||||||
atattTCCCATATTTCCAATCc
mmu-miR-677 16.8281 -14.01 3.545550e-02 3.483430e-02 2.433030e-02 192 213
agucuucGAUUAGUAGUGACUu
       ||   :||||||||
tgcccttCTTTGTATCACTGAc
hsa-miR-622 16.8033 -17.55 3.845010e-02 3.772030e-02 4.173140e-04 8 26
cgaGGUUGGAGUCGUCUGACa
   ||||  | | |||||||
gggCCAA--TAACCAGACTGc
hsa-miR-206 16.7144 -20.2 4.312890e-02 4.221210e-02 1.270380e-03 113 133
GGUGUGUGAAGGAAUGUAAGGu
|| ||:|:||||  |:|||:|
CCCCATATTTCC-CATATTTCc
hsa-miR-615-5p 16.7144 -23.34 5.587610e-02 5.434370e-02 3.980490e-02 71 93
CUA-GGCUCGUGGCCCCUGGGGg
||| |:|  |  |  |||||||
GATGCTGTCCTGCCTGGACCCCa
hsa-miR-328 16.6007 -12.59 5.638910e-02 5.482870e-02 4.019830e-02 1 14
ugccuuccCGUCUCUCCCGGUc
        | | | |||||||
--------GAAAAAAGGGCCAa
hsa-miR-329 16.6007 -12.67 2.903520e-02 2.861770e-02 3.325210e-03 50 71
uuucuccaaUUGGUCCACACAa
         |:|  |||||||
caaactcacAGCATGGTGTGTg
hsa-miR-410 16.5746 -10.99 3.074310e-02 3.027530e-02 3.639860e-03 202 222
uguccgguagacACAAUAUAa
            ||||||||
tgtatcactgacTGTTATATg
mmu-miR-683 16.5746 -23.27 3.779390e-02 3.708860e-02 2.607910e-02 42 64
CUCCU-GUG-UCGAAUGUCGUcc
||||| ||| | || ||||||
GAGGATCACAAACTCACAGCAtg
hsa-miR-212 16.5746 -12.69 2.114830e-02 2.092620e-02 2.092620e-02 198 218
ccggcacugaccuCUGACAAU
             ||||||||
tctttgtatcactGACTGTTA
hsa-miR-423-5p 16.5172 -21.1 7.364110e-02 7.099490e-02 3.798840e-03 178 200
uuucagaGCGAGAGACGGGGAGu
       :|:||  |||||:||
ccccaaaTGTTCCATGCCCTTCt
hsa-miR-132 16.487 -12.34 2.357890e-02 2.330310e-02 2.330310e-02 197 218
gcugguaccgacauCUGACAAU
              ||||||||
ttctttgtatcactGACTGTTA
hsa-miR-377 16.487 -13.5 4.145690e-02 4.060930e-02 1.229880e-03 52 73
uguuuucaacggaaACACACUA
              ||||||||
aactcacagcatggTGTGTGAT
mml-miR-103 16.4041 -17.99 4.932680e-02 1.177290e-03 2.145180e-05 206 227
AGUAUCGGGACAUGUUACGACGA
|||  | |:  ||: |||:||||
TCACTGACTGTTAT-ATGTTGCT
hsa-miR-216a 16.3733 -19.22 5.216620e-02 5.082890e-02 5.234280e-05 13 34
agugucaaCGGUCGACUCUAAU
        | | ||||||:||:
aataaccaGACTGCTGAGGTTG
mml-miR-15a 16.3733 -18.68 5.965010e-02 1.709880e-03 1.391290e-04 56 77
GUGUUUGGUAAUACACGACGAU
||||:  :: |:|||| ||||:
CACAGCATGGTGTGTGATGCTG
mml-miR-107 16.2909 -16.52 5.351390e-02 1.381800e-03 1.961170e-04 205 227
acuaucggGACAUGUUACGACGA
        ||||   |||:||||
atcactgaCTGTTATATGTTGCT
hsa-miR-299-3p 16.2596 -14.09 4.028280e-02 3.948220e-02 2.794840e-02 101 121
uUCGCCAAAUGGUAGGGUGUAu
 :| || ||| :: ||||:||
cGGAGGCTTA-TGCCCCATATt
hsa-miR-362-3p 16.2596 -10.43 3.394740e-02 3.337770e-02 2.157680e-04 51 71
acUUAGGAACUUAUCCACACAa
  | ||   | || |||||||
aaACTCACAGCAT-GGTGTGTg
hsa-miR-195 16.2317 -10.64 6.256310e-02 6.064620e-02 4.494540e-02 208 228
cGGUUAUAAAGACACGACGAu
 |::|   || | ||:||||
aCTGACTGTTATATGTTGCTt
mml-miR-194 16.1459 -12.1 4.065080e-02 3.983560e-02 3.983560e-02 200 220
AGGUGUACCUCAACGACAAUGU
|::::||  | |  ||||||:|
TTTGTAT-CACTGACTGTTATA
hsa-miR-576-3p 16.1459 -11.92 6.679990e-02 6.461760e-02 4.821450e-02 111 132
cuaaGGUUAAAAAGGUGUAGAa
    |||  ||| |||:||:|
tgccCCATATTTCCCATATTTc
hsa-miR-144 16.0929 -9.99 6.548160e-02 6.338370e-02 1.110020e-03 59 79
UCAUGUAGUAGA-UAUGACAu
|| |:: ::| | ||:||||
AGCATGGTGTGTGATGCTGTc
hsa-miR-767-5p 16.0647 -18.07 6.033680e-02 5.855260e-02 1.975920e-03 50 69
GUACGAGUCUGUUGGUACCACGU
||  |||  |||: |||||||::
CAAACTC--ACAG-CATGGTGTG
hsa-miR-499-3p 16.0322 -18.78 4.327850e-02 4.235540e-02 4.235540e-02 54 76
ucGUGUCUGAACG-ACACUACaa
  |||||  | |: |||||||
ctCACAGCATGGTGTGTGATGct
hsa-miR-603 15.8047 -14.66 6.484000e-02 6.278260e-02 4.026960e-04 48 71
cguUUUCAUUAACG--UCACACAC
   ||| | |  ||  :|||||||
cacAAACTCACAGCATGGTGTGTG
mml-miR-31 15.7745 -18.05 7.527410e-02 7.251080e-02 7.137920e-04 215 235
gucgAUACGGUCGUAGAACGG
    ||||::: : |||||||
gttaTATGTTGCTTTCTTGCC
hsa-miR-891b 15.691 -13.23 5.366200e-02 5.224760e-02 3.810900e-02 206 227
AGUUACUGAGUCCAUUCAACGu
||| |||||    || |||||
TCACTGACTGTTATATGTTGCt
hsa-miR-485-3p 15.691 -14.08 5.232470e-02 5.097930e-02 7.336860e-03 52 73
ucucuccUCUCGGCACAUACUG
       ||  : ||||:|||:
aactcacAGCATGGTGTGTGAT
hsa-miR-518a-5p 15.6331 -9.42 9.095670e-02 8.694280e-02 6.818710e-03 187 206
cuuuccCGAAGGGAAACGUc
      ||  ::|||||:|
ttccatGCCCTTCTTTGTAt
hsa-miR-543 15.2362 -10.4 9.737400e-02 9.278340e-02 7.786950e-03 168 189
uucuuCACGUGGCGCUUACAAa
     |||: || | ||||||
cccctGTGTTCCCCAAATGTTc
hsa-miR-487a 15.1225 -10.55 8.148180e-02 7.825050e-02 1.168450e-02 53 74
uugaccuacagggACAUACUAa
             |||:||||
actcacagcatggTGTGTGATg
hsa-miR-885-5p 15.1225 -17.39 7.067790e-02 6.823800e-02 1.818230e-02 56 76
ucucCGUCCCAUCACAUUACcu
    ||| ||| ||||:|||
cacaGCATGGT-GTGTGATGct
hsa-miR-339-3p 15.0465 -14.85 5.235000e-02 5.100330e-02 9.636550e-04 142 164
gccGAGACAGCAGCUCCGCGAGu
   | ||||  |: |||| |||
cacCCCTGTGCTTCAGGCCCTCc
hsa-miR-517c 14.6677 -14.05 8.473240e-02 8.124190e-02 2.261330e-02 51 73
UGUGAG-AUUUUCCUACGUGCUA
| ||||  |: | |:||:::|||
AAACTCACAGCATGGTGTGTGAT
Features
AFFY_Rhesus MmuSTS.2693.1.S1_at
HUGO 4810
spacer
spacer