spacer

Target Detailed View


Hit information for ENSMMUT00000029745

Gene Name DLL1
Transcript ENSMMUT00000029745
Gene ENSMMUG00000021144
Description Delta-like protein 1 precursor (Drosophila Delta homolog 1) (Delta1) (H-Delta-1). [Source:Uniprot/SWISSPROT;Acc:O00548]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
hsa-miR-499-3p 17.1856 -16.02 1.558750e-02 1.546660e-02 7.774030e-03 574 595
UCGUGUCUGAACGACACUACAA
||| :: :: | :|||||||||
AGCTTGAGTATTTTGTGATGTT
mmu-miR-467a 16.8787 -20.71 1.988860e-02 1.988860e-02 1.759950e-04 620 641
gcgUAUAUGUACGUCCGUGAAu
   ||||::|   ||||||||
taaATATGTACAAAGGCACTTc
hsa-miR-423-3p 16.8023 -30.77 1.572830e-02 1.560530e-02 1.627590e-03 229 247
UGACUCCCCGGAGUCUGGCUCGa
||||||    :|||||||||||
ACTGAG----TTCAGACCGAGCa
mmu-miR-322 16.6741 -20.81 5.157990e-02 5.027220e-02 7.009400e-06 203 224
agguuuuGUACUUAACGACGAC
       ::||:| ||||||||
gaggcctTGTGGACTGCTGCTG
hsa-miR-424 16.6741 -19.26 5.003940e-02 4.880810e-02 6.123240e-06 203 224
aaguuuuGUACUUAACGACGAC
       ::||:| ||||||||
gaggcctTGTGGACTGCTGCTG
hsa-miR-301b 16.4968 -19.81 4.802470e-02 4.747460e-02 1.899710e-04 317 339
cgaaACUGUUAUAGUAACGUGAc
    ||||:  : |:|||||||
tccgTGACGTCGCCGTTGCACTa
hsa-miR-301a 16.4968 -18.04 4.863850e-02 4.747460e-02 1.899710e-04 317 339
cgaaACUGUUAUGAUAACGUGAc
    ||||:  :| :|||||||
tccgTGACGTCGCCGTTGCACTa
hsa-miR-449b 16.4695 -22.11 5.640640e-02 3.973330e-03 1.664870e-04 391 412
cggucgaUUGUUAUGUGACGGA
       ||  ||:||||||||
gcataagAAGCATGCACTGCCT
hsa-miR-449b 16.3672 -21.9 6.232180e-02 3.973330e-03 1.664870e-04 454 476
cggucgaUUGU-UAUGUGACGGA
       |||| | |||||||||
aattagaAACACAAACACTGCCT
hsa-miR-589 16.3672 -19.55 3.211370e-02 3.160350e-02 8.336410e-06 235 255
GAGUCUCGUCUGCACCAAGAGu
:||||| |: :|  |||||||
TTCAGACCGAGC-AGGTTCTCc
hsa-miR-548c-5p 16.3672 -20.88 9.792520e-02 9.328330e-02 1.870020e-02 780 800
ccGUUUUUGGCGUUAAUGAAaa
  ||:||: ||:|:||||||
acCAGAAGGCGTAGTTACTTg-
hsa-miR-562 16.3217 -16.41 4.742360e-02 4.631670e-02 6.282610e-03 781 800
cGUUUACCAUGUCGAUGAAa
 ||:| || ::||:|||||
cCAGAAGGCGTAGTTACTTg
mml-miR-103 16.2931 -24.02 5.460180e-02 5.313790e-02 2.336490e-07 169 192
aGUAU-CGGGACAUGUUACGACGA
 :||| ||||     |||||||||
aTATATGCCCCAACGAATGCTGCT
mmu-miR-350 16.2649 -9.28 4.389320e-02 4.294380e-02 6.338380e-04 571 592
cUUUCACAUACCCGAAACACUu
 ||||  |: |  :|||||||
tAAAGCTTGAGTATTTTGTGAt
hsa-miR-449a 16.2649 -20.07 6.839210e-02 3.973330e-03 1.664870e-04 455 476
UGGUCGAUUGU-UAUGUGACGGu
|::||  |||| | ||||||||
ATTAG-AAACACAAACACTGCCt
hsa-miR-876-5p 16.1626 -10.19 6.566300e-02 6.355360e-02 4.033280e-02 718 739
accACUAAGUGUUUCUUUAGGu
   | :|| |::|||||||:|
gttTTGTTAATGAAGAAATTCc
mmu-miR-699 16.1151 -20.74 6.164550e-02 5.978390e-02 4.009060e-05 393 412
gcucggUCCAGCGUGACGGA
      ||  :|||||||||
ataagaAGCATGCACTGCCT
hsa-miR-611 16.0894 -26.41 2.686790e-02 2.651020e-02 1.456380e-02 248 270
cagucuGGGGCUCCCCAGGAGCg
      ||:|  | ||||||||
ggttctCCTCCTGAGGTCCTCGa
mml-miR-107 16.0894 -21.99 6.426460e-02 3.385350e-03 1.440490e-07 169 192
acUAU-CGGGACAUGUUACGACGA
  ||| ||||     |||||||||
atATATGCCCCAACGAATGCTGCT
mmu-miR-291b-3p 16.0603 -14.39 6.759140e-02 6.535770e-02 9.366470e-04 389 410
UGUUUGUUUUACCUACGUGAaa
||: |:||:| | |||||||
ACGCATAAGAAGCATGCACTgc
hsa-miR-518d-5p 16.0603 -16.42 6.029480e-02 5.851310e-02 3.663110e-02 496 516
gUCUUUCACGAAGGGAGAUCUc
 | || |||||| ::||||||
gAAAATGTGCTT-TTTCTAGAt
hsa-miR-519a 16.0603 -16.12 6.024550e-02 3.513410e-03 1.844670e-04 389 410
UGUGAGAUUUUCCUACGUGAaa
||:| : |:||| |||||||
ACGCATAAGAAGCATGCACTgc
hsa-miR-497 16.0343 -18.35 8.194330e-02 4.406490e-03 1.759860e-06 173 193
UGUUUGGUGUCACACGACGAC
|::  |||  |  ||||||||
ATGCCCCAACGAATGCTGCTG
hsa-miR-455-3p 16.0343 -20 5.098490e-02 4.970700e-02 6.713170e-03 199 219
cacauauacGGGUACCUGACG
         |:::||||||||
gagggaggcCTTGTGGACTGC
hsa-miR-449a 15.958 -19.51 9.190640e-02 3.973330e-03 1.664870e-04 391 412
uggucgaUUGUUAUGUGACGGu
       ||  ||:|||||||
gcataagAAGCATGCACTGCCt
hsa-miR-369-3p 15.8287 -11.76 8.430720e-02 8.085120e-02 2.261600e-03 515 535
UUUCUAGUUGGUACAUAAUAA
| :||  |: ::|||:|||||
ATGGAAAAGATGTGTGTTATT
hsa-miR-497 15.8287 -21.11 9.694810e-02 4.406490e-03 1.759860e-06 204 224
uguuuGGUGUCACACGACGAC
     :::::|  ||||||||
aggccTTGTGGACTGCTGCTG
mml-miR-107 15.7839 -28.32 8.463010e-02 3.385350e-03 1.440490e-07 201 223
aCUAUCGGGACAUGUUACGACGA
 |: :|||:|||: | |||||||
gGGAGGCCTTGTGGACTGCTGCT
hsa-miR-454 15.7839 -16.87 8.698670e-02 8.331070e-02 1.214760e-03 317 339
uGGGAUAUUCGUUAUAACGUGAU
 || |:  : |:  :||||||||
tCCGTGACGTCGCCGTTGCACTA
hsa-miR-425 15.7839 -16.19 3.443220e-02 3.384620e-02 1.935880e-02 512 535
AGUUGCCCUCACUA-GCACAGUAA
| :|:|| |  ||| :||||:|||
TAGATGGAAAAGATGTGTGTTATT
mml-miR-15b 15.7534 -19.13 9.484510e-02 9.048620e-02 1.608940e-05 203 224
acauuuGGUACUACACGACGAU
      :::||:  |||||||:
gaggccTTGTGGACTGCTGCTG
hsa-miR-362-5p 15.7158 -14.81 7.148750e-02 6.899210e-02 1.680360e-04 148 171
ugaguguggauccAAGGUUCCUAa
             ||||||||||
aaaataagtaaaaTTCCAAGGATa
hsa-miR-363 15.6511 -18.8 6.044250e-02 5.865210e-02 9.709530e-03 676 698
AUGUCUACC-UAUGGCACGUUaa
||:  |||| |||::||||||
TATTTATGGAATATTGTGCAAat
mmu-miR-688 15.5986 -19.64 5.130070e-02 5.000700e-02 3.050500e-02 289 308
cuuauucaUCAGCGGACGCU
        :| ||||||||:
cacggcccGGCCGCCTGCGG
hsa-miR-519e 15.5488 -12.03 8.626250e-02 3.513410e-03 1.844670e-04 622 640
UUGUGAGAUUUUCCUCCGUGAA
||:| | || ||  ||||||||
AATA-TGTACAA--AGGCACTT
hsa-miR-507 15.5204 -8.44 8.926730e-02 8.539890e-02 1.196470e-02 678 698
AAGUGAGGUUUUCCACGUUUu
||:|:   | |  |||||||
TTTATGGAATATTGTGCAAAt
hsa-miR-152 15.4176 -17.46 9.532900e-02 9.092620e-02 1.538530e-03 390 410
gguucaagacaGUACGUGACu
           |||||||||
cgcataagaagCATGCACTGc
mmu-miR-467b 15.4176 -20.96 8.671410e-02 8.306080e-02 1.759950e-04 622 642
gUAUAUGUACGUCCGUGAAug
 ||||::|   ||||||||
aATATGTACAAAGGCACTTcg
hsa-miR-338-5p 15.3442 -10.14 9.730700e-02 9.272260e-02 5.807060e-03 672 693
gUGAGUCGUGGUCCUAUAACAa
 |: :| :  ::| |||||||
aATGTATTTATGGAATATTGTg
hsa-miR-660 15.2419 -12.44 7.716710e-02 7.426480e-02 8.332460e-03 357 379
guugaggcUAUACG-UUACCCAU
        |||| : |||||||:
aagaatatATATTTAAATGGGTG
mmu-miR-714 15.212 -27.97 5.890990e-02 5.720830e-02 2.538840e-02 11 31
CGCUGGCUGGCCGGGAGCAGc
|||:||| :|| :|||| ||
GCGGCCGCTCGCTCCTCCTCa
hsa-miR-208b 14.8328 -13.96 9.395550e-02 8.967670e-02 6.431190e-03 74 95
UGUUUGGAAAACAAGCAGAAUA
:| |||:|    ||:|||||:|
GCTAACTTCCCATTTGTCTTGT
hsa-miR-517b 14.7305 -13.68 9.227960e-02 8.814980e-02 1.414900e-03 388 409
uUGUGAGAUUUCCCUACGUGcu
 ||:| : |:| | ||||||
tACGCATAAGAAGCATGCACtg
hsa-miR-585 14.6432 -12.65 7.974610e-02 7.664920e-02 2.640970e-03 161 179
aucGUAUGUCUAUGCGGGu
   || : | |||:||||
ttcCAAGGATATATGCCCc
Features
AFFY_Rhesus MmuSTS.4065.1.S1_at
AFFY_Rhesus MmugDNA.29072.1.S1_at
HUGO 2908
spacer
spacer