spacer

Target Detailed View


Hit information for ENSMMUT00000029070

Gene Name CCNE1
Transcript ENSMMUT00000029070
Gene ENSMMUG00000020668
Description G1/S-specific cyclin-E1. [Source:Uniprot/SWISSPROT;Acc:P24864]
Alignment View [HTML] [Java]
Hit infomation
Rfam ID Score Energy Base P Poisson P Org P Start End Alignment
mml-miR-16 18.0407 -16.4 1.329990e-02 1.321180e-02 8.000240e-09 481 502
GCGGUUAUAAAUGCACGACGAU
| |:: | | || |||||||||
CTCTGTTTTGTAAGTGCTGCTA
mml-miR-141 17.3798 -16.58 1.600990e-02 1.588240e-02 1.588240e-02 443 463
gGUAGAAAUGGUCUGUCACAa
 |||: | | : ||||||||
aCATTATCAGTTGACAGTGTa
hsa-miR-548c-5p 17.08 -20.7 5.698130e-02 5.698130e-02 7.488280e-03 71 93
cCGUUUUUG-GCGUUAAUGAAAA
 ||::|::| :||: ||:|||||
aGCGGAGGCGTGCGTTTGCTTTT
hsa-miR-195 17.058 -16.45 3.147150e-02 3.098140e-02 7.191540e-07 482 502
cGGUUAUAAAGACACGACGAU
 |:: | | |  |||||||||
tCTGTTTTGTAAGTGCTGCTA
hsa-miR-328 16.8665 -19.85 4.690100e-02 4.581810e-02 4.581810e-02 305 326
UGCCUUCCCGUCUCUCCCGGUc
:|  :| | :| :||||||||
GCTTGAAGCTATGGAGGGCCAc
hsa-miR-148b 16.8665 -20.75 2.020830e-02 2.020830e-02 2.020830e-02 346 367
ugUUUCAAGACACUACGUGACu
  :: |||||| | ||||:||
cgGGTGTTCTGGGCTGCATTGt
mml-miR-15a 16.8665 -15.66 3.929720e-02 3.929720e-02 1.086620e-07 481 502
GUGUUUGGUAAUACACGACGAU
| | : ::  || |||||||||
CTCTGTTTTGTAAGTGCTGCTA
hsa-miR-548d-5p 16.7597 -15.95 8.540320e-02 8.185800e-02 7.488280e-03 71 93
cCGUUUUUG-GUGUUAAUGAAAA
 ||::|::| ::|: ||:|||||
aGCGGAGGCGTGCGTTTGCTTTT
hsa-miR-548a-5p 16.7597 -14.87 7.429730e-02 7.429730e-02 7.488280e-03 72 93
ccaUUUUGAGCGUUAAUGAAAA
   :|::| :||: ||:|||||
gcgGAGGCGTGCGTTTGCTTTT
mml-miR-107 16.6806 -22.3 3.746130e-02 1.005150e-03 7.838940e-08 480 501
acuauCGGGACAUGUUACGACGA
     |:::|||| |:|||||||
actctGTTTTGTA-AGTGCTGCT
mml-miR-103 16.6806 -22.3 3.824940e-02 1.048700e-03 8.492190e-09 480 501
aguauCGGGACAUGUUACGACGA
     |:::|||| |:|||||||
actctGTTTTGTA-AGTGCTGCT
hsa-miR-515-3p 16.653 -20.2 3.217530e-02 3.166320e-02 3.166320e-02 252 273
UUGCGAGGUUUUCUUCCGUGAg
||:||| | | :|||||::||
AATGCTGCTATGGAAGGTGCTa
hsa-miR-299-3p 16.653 -22.52 2.646100e-02 2.611400e-02 2.611400e-02 425 447
uUCGCCAAAUGGUA-GGGUGUAu
 || || ||:|::| :||||||
cAGGGGGTTGCTGTCTCCACATt
mml-miR-218 16.6288 -17.15 2.948770e-02 2.905720e-02 2.262150e-04 200 220
UGUACCAAUCUAGUUCGUGUu
| ||   |:|:|||||:|||
AAATAAGTGGGTCAAGTACAc
hsa-miR-138 16.5743 -20.22 4.232680e-02 4.144350e-02 4.334730e-03 202 225
gccggACUAAGUGU-UGUGGUCGa
     ||: ||| : ||||||||
ataagTGGGTCAAGTACACCAGCc
mml-miR-29a 16.5462 -14.46 2.088780e-02 2.067120e-02 4.985180e-06 254 274
uUGGCUAAAGUCUACCACGAUc
 :|:| | | :|| |||||||
tGCTGCTAT-GGAAGGTGCTAc
hsa-miR-148a 16.5462 -20.03 2.934610e-02 2.891970e-02 2.891970e-02 346 367
ugUUUCAAGACAUCACGUGACu
  :: |||||| : ||||:||
cgGGTGTTCTGGGCTGCATTGt
mmu-miR-669a 16.5462 -15.16 4.337500e-02 4.244780e-02 4.244780e-02 278 298
UGUACUUGUACGUGUGUGUUGa
|| |||: :  | ||||||||
ACCTGAG-GGACTCACACAACa
rno-miR-352 16.5215 -17.9 3.756470e-02 3.686790e-02 3.597840e-02 257 277
AUGAUACGUUGGAUGAUGAGa
|:||||| ||  |:|||||:
TGCTATGGAAGGTGCTACTTg
hsa-miR-644 16.484 -16.07 3.840050e-02 3.767250e-02 2.684550e-03 17 35
cgaGAUUCUUUCGGUGUGa
   | |||| ||:|||||
cacCAAAGACAGTCACACg
mml-miR-103 16.4681 -22.98 4.651160e-02 1.048700e-03 8.492190e-09 238 260
aguaucgggacauGUUACGACGA
             ||||||||||
cagtgcgtgctccCAATGCTGCT
mml-miR-107 16.4681 -20.09 4.552060e-02 1.005150e-03 7.838940e-08 238 260
acuaucgggacauGUUACGACGA
             ||||||||||
cagtgcgtgctccCAATGCTGCT
mml-miR-15b 16.4395 -15.66 5.340320e-02 5.200230e-02 1.086620e-07 482 502
ACAUUUGGUACUACACGACGAU
| |:  :::| | |||||||||
TCTGTTTTGT-AAGTGCTGCTA
hsa-miR-600 16.2556 -16.06 4.857990e-02 4.741880e-02 3.215560e-04 474 495
CUCGUUCCGAGAACAGACAUUCA
|| ::|  ||||  |:|||||||
GAATGA-ACTCTGTTTTGTAAGT
hsa-miR-134 16.226 -24.65 4.262960e-02 4.173370e-02 4.173370e-02 9 33
GGGGAGACCAG---UUGGUCAGUGU
:||:|||   |   |: ||||||||
TCCTTCTCCACCAAAGACAGTCACA
hsa-miR-521 16.226 -14.67 1.619460e-02 2.490470e-03 1.275860e-03 225 246
uguGAGAUUUCCCUUCACGCAa
   ||| |:|    |||||||
cacCTCCAGACACCAGTGCGTg
hsa-miR-524-3p 16.1997 -21.84 2.408660e-02 2.379880e-02 1.780640e-03 26 46
ugaGGUUUCCCUUCGCGGAag
   :|| | ||||||||||
cagTCACACGGAAGCGCCTgc
rno-miR-333 16.1771 -17.82 4.886840e-02 4.769360e-02 5.227460e-05 204 223
UUUUCAUUGAUCGUGUGGUg
||: | : | ||:||||||
AAGTGGGTCAAGTACACCAg
hsa-miR-627 16.1192 -22.62 4.511760e-02 4.411490e-02 4.411490e-02 270 292
aGGAGAA-AAGAAUCUCUGAGUG
 |: |||   || ||:|||||||
gCTACTTGACCTGAGGGACTCAC
mmu-miR-547 16.0924 -16.43 4.085470e-02 4.003140e-02 3.908940e-02 353 373
gagugaguuucuACAUGGUUC
            |||||||||
tctgggctgcatTGTACCAAG
hsa-miR-562 16.0692 -13.65 5.983560e-02 5.808060e-02 1.473650e-03 257 277
cguuUACCAUGU-CGAUGAAa
    |||| | : |||||||
tgctATGGAAGGTGCTACTTg
hsa-miR-922 16.0431 -20.87 8.438380e-02 8.092160e-02 1.171960e-02 49 70
cUGCAUCAGGAUAAGAGACGACG
 ||||  ||:|  | ||||:|||
cACGTTCTCTT-CTGTCTGTTGC
hsa-miR-654-5p 16.0125 -25.94 6.829430e-02 6.601440e-02 2.270450e-02 392 415
CGUGUACAAGACG-C-CGGGUGgu
||| ||||| ||| | ||||||
GCAAATGTTGTGCAGAGCCCACag
hsa-miR-516b 16.0125 -16 8.742170e-02 8.370940e-02 1.461170e-02 214 235
uuucacgaagaaUGGAGGUCUa
            |||||||||
agtacaccagccACCTCCAGAc
hsa-miR-518a-3p 16.0125 -15.97 2.454400e-02 2.224950e-03 1.053250e-03 153 174
AGGUCGUUUCCCUUCGCGAAAG
|| | ||::|  |||:|:|||:
TCGAACAGGGCAAAGTGTTTTT
mmu-miR-322 15.9057 -10.43 9.759170e-02 9.298080e-02 1.275630e-03 482 502
AGGUUUUGUACUUAACGACGAc
||::   ::| || |||||||
TCTGTTTTGT-AAGTGCTGCTa
hsa-miR-330-3p 15.8306 -12.11 7.221380e-02 6.966800e-02 1.055570e-03 469 491
aGAGACGUCCGGCACACGAAACG
 ||:|| | |   | ||:||||:
cCTTTGAATGAACTCTGTTTTGT
hsa-miR-498 15.6181 -15.04 8.233290e-02 7.903470e-02 7.644280e-04 290 312
cuuuuugcgggggaCCGAACUUU
              ||||||||:
cacacaacaacaaaGGCTTGAAG
hsa-miR-599 15.53 -15.97 8.799350e-02 8.423320e-02 9.667980e-04 278 297
caaACUAUUUGACUGUGUUG
   ||| ::||| |||||||
accTGAGGGACTCACACAAC
hsa-miR-518a-3p 15.4787 -23.78 4.177300e-02 2.224950e-03 1.053250e-03 68 89
AGGUCGUUUCCCUUCGCGAAag
| ||||::||| : |||:||
TGCAGCGGAGGCGTGCGTTTgc
hsa-miR-525-3p 15.372 -19.76 4.937770e-02 4.817840e-02 4.790400e-03 25 46
gcgagaUUUCCCUUCGCGGAag
      | | ||||||||||
acagtcACACGGAAGCGCCTgc
hsa-miR-523 15.0869 -21.79 2.510270e-02 2.479020e-02 1.459650e-02 62 87
UGGGAGAUAUC-CCUU--CGCGCAAG
::|: :|: || |||:  |:|||||:
GTCTGTTGCAGCGGAGGCGTGCGTTT
hsa-miR-614 14.9807 -20.01 8.506500e-02 8.154740e-02 1.468820e-02 60 83
GGUGGACCGU-UCUUGUCCGCAag
|:::||| :: || : ||||||
CTGTCTGTTGCAGCGGAGGCGTgc
mmu-miR-463 14.945 -7.92 9.756920e-02 9.296040e-02 6.243540e-04 48 69
GAUGGAAUAUACCACAGAUAGU
| || || | |  |||||:|::
CCACGTTCTCTTCTGTCTGTTG
hsa-miR-518d-3p 14.9123 -13.58 6.823780e-02 2.224950e-03 1.053250e-03 154 174
cgagGUUUCCCUUCGCGAAAc
    ||::|  |||:|:|||
cgaaCAGGGCAAAGTGTTTTt
hsa-miR-192 14.9123 -10.69 8.478420e-02 8.128950e-02 3.738920e-03 194 214
ccgacagUUAAGUAUCCAGUc
       |||  :|:|||||
nnnnnnaAATAAGTGGGTCAa
mml-miR-215 14.9123 -10.97 8.165620e-02 7.841130e-02 2.653120e-04 194 214
cagacagUUAAGUAUCCAGUa
       |||  :|:|||||
nnnnnnaAATAAGTGGGTCAa
hsa-miR-521 14.7315 -17.08 7.229180e-02 2.490470e-03 1.275860e-03 98 119
UGUGAGAUUUCCCUUCACGCAA
|:|: : ||| ||||| |:|||
ATATCTAAAATGGAAGAGTGTT
hsa-miR-891a 14.6247 -27.8 5.955480e-02 5.781610e-02 3.627380e-05 370 390
agUCACCGAGUCCAAGCAACGU
  |||||  |||| | |||||:
caAGTGGAGCAGG-TGGTTGCG
Features
AFFY_Rhesus MmugDNA.4085.1.S1_at
HUGO 1589
spacer
spacer